1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
juin [17]
3 years ago
7

PLEASE ANSWER!!!!

Biology
2 answers:
Gekata [30.6K]3 years ago
6 0

Answer:

(D) Z

Explanation:

Cellular respiration is a catabolic process by which cells produce energy by oxidising respiratory substrates such as glucose. It is a multistage process occurs in cytoplasm and in mitochondria of a cell. The first stage of cellular respiration is called glycolysis or EMP (Embden, Meyerhof and Parnas) pathway. This stage occurs in the cytoplasm of a cell which is labeled by Z in the given image.    

Aleks [24]3 years ago
5 0

Answer:(D)Z    

Explanation:Got a 100%

You might be interested in
What is the mRNA in TACCGGATGCCAGATCAAATC?
Softa [21]

Answer:

AUGGCCUACGGUCUAGUUUAG

3 0
3 years ago
What is a carrying capacity? Please explain in two or more sentences.
Mademuasel [1]

Hello!

Carrying capacity, in biology, is the mps (maximum population size) of the species that the environment is able to take care of.  The environment should be able to give food, habitat, and water, and other necessities needed for the certain animal species. If there are to many of the species, the environment may not be able to care for all animals, due to the fact that there will not be enough resources for all of the animals.

Hope this helps, have an awesome day/night! :)

3 0
3 years ago
A balanced chemical equation?
Strike441 [17]
A balance chemical equation is an equation describing a chemical reaction with the right number of molecules to cancel out each side of the equation.
For example:
H2 + O2 —> H2O
Make sure the number of molecules in your reactants equal the number of molecules in your product
2H2 + O2 —> 2H2O
(4 hydrogens and 2 oxygens = 4 hydrogens and 2 oxygens)
8 0
3 years ago
Animated neon signs seem to move even when no physical movement
Gnom [1K]
This illusion is an example of what you called an INDUCED  MOVEMENT. It is called an induced movement because animated neon signs seem to move even though there is no physical movement in them. Induced movement or induced motion is an illusion in which people tend look into it moving even it is really not moving. 
6 0
3 years ago
What type of fibers are not man made?
Marrrta [24]

Some man-made fibres, too, are derived from naturally occurring polymers. For instance, rayon and acetate, two of the first man-made fibres ever to be produced, are made of the same cellulose polymers that make up cotton, hemp, flax, and the structural fibres of wood.

8 0
3 years ago
Other questions:
  • How would you expect the stomata of a leaf respond to a drought
    12·1 answer
  • Which type of change was seen in the ecosystems affected by the 1988 fires in Yellowstone Park?
    13·1 answer
  • The order of nucleotides in a gene affects the proper protein functioning in cells.
    14·1 answer
  • _____________ are present in an organism, but they don't function in the same way they used to. HELP ILL GIVE BRAINLIEST!!! pict
    12·1 answer
  • Which bird is best adapted to survive in an environment dominated by seed-bearing plants?
    5·1 answer
  • Explain how a person can be a carrier for a sex-linked disorder, but not exhibit this disorder.
    15·1 answer
  • Hi guys can you guys help me with this question plsss​
    7·2 answers
  • Ecosystems with a high level of species diversity tend to be more ____________________ in the event of environmental changes.
    12·2 answers
  • Why is suspect 1 considered more likely to have committed the crime than suspect 2?
    5·1 answer
  • Ron is observing an onion cell on a slide under a microscope. He sees chromatids being pulled to opposite ends of the cell. Whic
    7·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!