1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Setler79 [48]
2 years ago
14

What is Newton's Third Law of Motion?

Biology
2 answers:
NISA [10]2 years ago
5 0
A) for every action there is equal and opposite reaction

Bumek [7]2 years ago
4 0
The answer to this question is A. A simple Google search will help you find the answer. But, straightforward. That's what he stated in the document he made as the third law. So, that's the answer. Period.
You might be interested in
Where does glycolysis and fermentation take place in the cell membrane?
Elina [12.6K]
They take place in the cytoplasm
8 0
3 years ago
How are the west flowing rivers different from the east flowing rivers
Kazeer [188]
Is this just in general or in a certain area?
8 0
3 years ago
The absence of
Svetlanka [38]
I believe it’s C :) mutations
8 0
2 years ago
Read 2 more answers
Is a behaviour that is learnt an example of an adaptation?
kipiarov [429]

Answer:

No adaptation is more of the environment or its surrounding EX: migration,courtship partners, forging behaviors.

while learning is a change in behaviors over a lifetime.

Explanation:

(i dont remmber much from this subject im possibly wrong)

8 0
3 years ago
Do some research online to determine what seafood in your state might not be safe to eat and explain what problems are common in
Dima020 [189]

Answer:

In India, in West Bengal, the shrimp found in a particular river were not deemed healthy to be eaten.

Explanation:

All water bodies have their own <em>food chains and ecosystems</em>. So basically in aquatic ecosystems, lot of marine animals are considered edible. The examples are fish, shrimp, prawn, lobster, crabs , etc are cooked and eaten.

Larger fish have a tendency to eat smaller fish. Anything that the smaller fish eats goes into the stomach of the larger fish and gets <em>accumulated</em>. Due to large industries not dumping their waste properly, lot of it falls into the water bodies. The waste contains toxic minerals like lead and mercury which when eaten by humans can cause poisoning.

Lead poisoning can cause loose motions, vomiting, cramps and infection in the abdomen etc.

5 0
3 years ago
Other questions:
  • Which is not a result of the agricultural revolution?
    12·2 answers
  • Near witch major city were iron works found
    9·1 answer
  • Which of the following is the most likely impact of clearing a forest to construct a highway?
    11·2 answers
  • How can islands be created by plate tectonics
    5·1 answer
  • Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequ
    11·1 answer
  • Mr. Lopez has been advised to watch his cholesterol intake to prevent a myocardial infarction. Which describes the
    9·2 answers
  • Which type of traits vary quantitatively due to the interaction of multiple genes? polygenic codominant incomplete dominant domi
    15·2 answers
  • I need this help! Please!
    12·1 answer
  • an air mass exists off the Pacific coast of California what type of air mass is this and what are its main characteristics choos
    13·1 answer
  • The disease known as malaria may result in a fever, a decrease in red blood cells, and an enlarged liver and spleen. These sympt
    10·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!