1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Sidana [21]
3 years ago
12

What kind of flowers are these?

Biology
2 answers:
Radda [10]3 years ago
8 0

Answer:

It is an iris

Explanation:

The petals and structure have the typical traits of an iris.

Julli [10]3 years ago
4 0
Answer: Iris Japonica
You might be interested in
On the graph to the right, indicate which curve corresponds to each type of chlorophyll. Which curve corresponds to chlorophyll
vladimir1956 [14]

Answer:

First question - Green curve

Second question - Red curve

Explanation:

6 0
3 years ago
Read 2 more answers
Can carbon atoms bond with other atoms to form long chains?
Aleks04 [339]

Answer:

yes

Explanation:

6 0
3 years ago
Read 2 more answers
A secondary consumer eats
Yuki888 [10]
Its either dead material or organisms that eat producers
4 0
4 years ago
what is the sequence of mRNA codons that are synthesized during transcription that go with TACCGGATGCCAGATCAAATC, TACGGGGGCGTAAC
VLD [36.1K]

Answer:

Tfftfxggfddsd

Explanation:

Because of the condons

7 0
3 years ago
I am a real "powerhouse" 
Bond [772]
Mitochondria is the powerhouse of the cell. Only thing I remember from middle school science
6 0
3 years ago
Other questions:
  • Sponges have collar cells that trap food and ingest it by proteasespinocytosisphagocytosis or by the enzymes of lysosomes
    13·2 answers
  • D.One year
    12·1 answer
  • A strand of mRNA has the bases guanine adenine cytosine. which amino acid corresponds to these bases
    5·2 answers
  • Movement of liquid or gas particles from a high to a low concentration
    11·2 answers
  • People cut down a forest to build a housing development. Describe two ways this action will likely affect the water cycle in the
    12·2 answers
  • Definition of invasive species ?
    14·2 answers
  • What are the two main structures of carbohydrates in living things? I’m so confused pls help
    13·1 answer
  • One of the most common plants in Atlantic salt marshes is cordgrass. periwinkle snails cling to the top of tall cord grass is du
    15·1 answer
  • If plant cells are grown on media containing radioactively labeled thymine for one generation, where will radioactively labeled
    12·1 answer
  • Which amino acid might be expected to have the least effect on the function of an enzyme if it replaces a glu residue in the enz
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!