Explanation:
Translation is the process by which a polypeptide is polymerized from genetic information.
Firstly we have to make a transcription from the coding DNA strand to a single RNA strand (mRNA). RNA pol reads from 5' to 3' of the template strand and nucleotides are added by complementarity ( Adenine with Uracil, Thymine with Adenine and Cytosine with Guanine, Guanine with Cytosine).
DNA: 5'- CGTTATGTGGACTCTCTGGTATGACTCACCTTAT -3'
mRNA: 5'-GCAAUACACCUGAGAGACCAUACUGAGUGGAAUA -3'
mRNA goes to the ribosomes where translation takes place. The enzyme will read every three letters (codon) starting at the start codon sequence (TAC in DNA, AUG in mRNA). According to codons tRNA carrying the amino acids will place it (by complementary to their anticodon) and the enzyme will join it to the nascent polypeptide or protein.
In order to do this we need to look up the genetic code and assign the proper amino acids.
Unfortunately the given strand does not have a start codon TAC codifying for initial methionine.
Okay so the answer will be.
Answer:
Landslides, Volcanoes, Earthquakes, and Floods. A opening in the Earth's surface through which melted rock, gases, and ash escape. Events in which molten rock spews out from the mantle to the surface of Earth as ash, lava, and gases
Explanation:
Answer:
The answer is 1.61 × 10²³ atoms
Explanation:
To determine number of atoms, we will use the formula below
Number of atoms = number of moles (n) × avogadro's constant (6.02 x 10²³)
n was not provided, hence we will solve for n
n = mass/ molar mass
molar mass of carbon monoxide, CO (where C is 12 and O is 16) is 12 + 16 = 28
mass was provided in the question as 7.48
n = 7.48/28
n = 0.267
Hence,
number of atoms = 0.267 × 6.02 x 10²³
= 1.61 × 10²³ atoms
Answer:
Ammonium bromide can be prepared by the direct action of hydrogen bromide on ammonia. It can also be prepared by the reaction of ammonia with iron(II) bromide or iron(III) bromide, which may be obtained by passing aqueous bromine solution over iron filings.
Explanation:
please mark me as brainliest thank you