1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
abruzzese [7]
4 years ago
11

Suppose 870.mmol of electrons must be transported from one side of an electrochemical cell to another in 84. seconds. Calculate

the size of electric current that must flow.
Chemistry
1 answer:
-BARSIC- [3]4 years ago
7 0

Answer:

The size of an electric current that must flow is 999.18 Ampere.

Explanation:

Moles of electrons passed, n = 870. mmol= 0.870 mol

1 mmol = 0.001 mol

Number of electrons =N=n\times N_A

Total charge on N electrons = Q = 1.602\times 10^{-19} C\times N

Duration of time in which N electrons were passed = T = 84. seconds

Amount of current passes = I

I=\frac{Q}{T}

I=\frac{1.602\times 10^{-19} C\times N}{84. s}

=\frac{1.602\times 10^{-19} C\times 0.870\times 6.022\times 10^{23}}{84. s}

I = 999.18 Ampere

The size of an electric current that must flow is 999.18 Ampere.

You might be interested in
DNA transcription-to-translation # 1 Homework Unanswered Due in 4 days Given the following sequence of the coding strand, writte
uysha [10]

Explanation:

Translation is the process by which a polypeptide is polymerized from genetic information.

Firstly we have to make a transcription from the coding DNA strand to a single RNA strand (mRNA). RNA pol reads from 5' to 3' of the template strand and nucleotides are added by complementarity ( Adenine with Uracil, Thymine with Adenine and Cytosine with Guanine, Guanine with Cytosine).

DNA:  5'-  CGTTATGTGGACTCTCTGGTATGACTCACCTTAT -3'

mRNA: 5'-GCAAUACACCUGAGAGACCAUACUGAGUGGAAUA -3'

mRNA goes to the ribosomes where translation takes place. The enzyme will read every three letters (codon) starting at the start codon sequence (TAC in DNA, AUG in mRNA). According to codons tRNA carrying the amino acids will place it (by complementary to their anticodon) and the enzyme will join it to the nascent polypeptide or protein.

In order to do this we need to look up the genetic code and assign the proper amino acids.

Unfortunately the given strand does not have a start codon TAC codifying for initial methionine.

3 0
3 years ago
50 POINTS!! PLEASE HELP!
inn [45]
Okay so the answer will be.
8 0
3 years ago
1.<br> Events in which molten rock spews out of<br> the mantle as ash, lava, and gases
Travka [436]

Answer:

Landslides, Volcanoes, Earthquakes, and Floods. A opening in the Earth's surface through which melted rock, gases, and ash escape. Events in which molten rock spews out from the mantle to the surface of Earth as ash, lava, and gases

Explanation:

6 0
3 years ago
1. How many ATOMS of carbon are present in 7.48 grams of carbon monoxide ?
Salsk061 [2.6K]

Answer:

The answer is 1.61 × 10²³ atoms

Explanation:

To determine number of atoms, we will use the formula below

Number of atoms = number of moles (n) × avogadro's constant (6.02 x 10²³)

n was not provided, hence we will solve for n

n = mass/ molar mass

molar mass of carbon monoxide, CO (where C is 12 and O is 16) is 12 + 16 = 28

mass was provided in the question as 7.48

n = 7.48/28

n = 0.267

Hence,

number of atoms = 0.267 × 6.02 x 10²³

= 1.61 × 10²³ atoms

3 0
4 years ago
What's the equation for the reaction of Trifluoro bromide with Ammonia gas. ( brainliest assured )​
sp2606 [1]

Answer:

Ammonium bromide can be prepared by the direct action of hydrogen bromide on ammonia. It can also be prepared by the reaction of ammonia with iron(II) bromide or iron(III) bromide, which may be obtained by passing aqueous bromine solution over iron filings.

Explanation:

please mark me as brainliest thank you

5 0
3 years ago
Other questions:
  • HELP ASAP AND ILL GIVE U BRAINLIEST
    13·1 answer
  • The independent variable has control and affects the
    5·2 answers
  • Which is a representation of a compound that gives the number of atoms and types of atoms in that compound? chemical formula sub
    11·2 answers
  • Definition: This is the phase of matter with no fixed shape or volume.
    14·2 answers
  • Which phrase describes the charge and mass of a neutron? 1. a charge of +1 and no mass 2. a charge of +1 and an approximate mass
    8·2 answers
  • Write the symbol for nitrogen which has 9 neutrons<br><br>How do I solve this?
    13·1 answer
  • Automobile air bags inflate following a serious
    8·1 answer
  • :( plz help and can u guys help me with my math
    15·2 answers
  • 2NaCl → 2Na +Cl2<br> What reaction is this
    9·1 answer
  • Need help with cemester​
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!