1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Zina [86]
3 years ago
9

A mitochondrial membrane complex consisting of ATP synthase, adenine nucleotide translocase (ATP-ADP translocase), and phosphate

translocase functions in oxidative phosphorylation. Adenine nucleotide translocase, an antiporter located in the inner mitochondrial membrane, moves ADP into the matrix and ATP out. Phosphate translocase is also located in the inner mitochondrial membrane. It transports H ions and phosphate (H2PO4–) ions into the matrix. The energy derived from the movement of H ions down an electrochemical gradient from the intermembrane space into the matrix is used to drive the synthesis of ATP. How many H ions must be moved into the matrix for the synthesis of 1 ATP?
Biology
1 answer:
Luden [163]3 years ago
8 0

Answer- what is the question

Explanation:

You might be interested in
9. What part of the body covers the windpipe when you swallow?
Sloan [31]

Answer:

epiglottis

Hope it helps:)

8 0
2 years ago
Read 2 more answers
Which of the following are limitations of HMO plans? (Select all that apply.)
anyanavicka [17]
B)<span>limited number of healthcare providers
&
c) </span><span>limited coverage for healthcare services

</span>
8 0
3 years ago
Read 2 more answers
8- Most gymnosperms have reproductive structure called cones<br> true<br> false
Alla [95]

┏─━─━─━─━∞◆∞━─━─━─━─┓

      ✭✮Here is your Answer✭✮

┗─━─━─━─━∞◆∞━─━─━─━─┛

Answer:

<u><em>True</em></u>

Explanation:

<u><em>Most gymnosperms have reproductive structures called cones. Male cones produce pollen. Female cones contain at least one ovule. An ovule is a structure that contains an egg cell. After being fertilized, the ovule develops into a seed.</em></u>

3 0
2 years ago
Read 2 more answers
The papillary muscles contract after the other ventricular muscles so that they can take up the slack on the chordae tendineae b
sashaice [31]

Answer:

False

Explanation:

The papillary muscles of both right and left ventricles began to contract shortly before the other ventricular muscles (systole) so that they can take up the slack on the chordae tendineae as the full force of ventricular contractions sends blood against the atrioventricular (AV) valve flaps.

They prevent the backward flow of blood to atria from ventricles. So if they contract after the ventricle systole they would not be able to perform their job.

8 0
3 years ago
Refer to the illustration above.<br> During which stage do the centromeres divide?
WARRIOR [948]

Answer:

esa es la separación de cromasonas

4 0
2 years ago
Other questions:
  • A stream of water holds thriving bacteria. If drought conditions caused the stream to dry up, how would the bacteria mostly like
    5·2 answers
  • Which statement is true of both active transport and facilitated diffusion?
    8·1 answer
  • Amino acids for- GACAAUGAAAGUUAGCAUGUGGUUGUGACGAAAG
    8·1 answer
  • Use your understanding of the nitrogen cycle to answer
    5·1 answer
  • What is the function of the;
    12·1 answer
  • Which part of the term deoxyribonucleic acid indicates where dna is located?
    6·1 answer
  • Which photosynthetic process can occur at night
    9·2 answers
  • The number of phenotypes produced for a given trait depends on
    11·2 answers
  • What is this? Please answer with an explanation
    12·1 answer
  • You are swimming in a shallow pond. You touch the bottom of the pond with your foot
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!