1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
xz_007 [3.2K]
3 years ago
6

Suppose you eat fatty cheeseburger at a 4th of July picnic. In order for your body to use the fat molecule, it must first be mix

ed with digestive enzymes from the pancreas and liver. The gallbladder adds bile salts, which help emulsify the fat. Finally, the small intestine absorbs the fat into the bloodstream. Most accurately, your digestive ___________digests the cheeseburger. A) glands B) organ C) system D) tissue
Biology
2 answers:
Vaselesa [24]3 years ago
8 0
(D tissue is the answer to your extremly long question
Alchen [17]3 years ago
7 0

C) system               ;;;;;;;;;;;;;;;;;;;;;;

You might be interested in
Which statement about air is correct?
NISA [10]

Answer:

Air is essential for almost all organisms.

Explanation:

7 0
3 years ago
Read 2 more answers
Which of the following are NOT correctly matched?
DedPeter [7]

Answer: immediate hypersensitivity: allergic contact dermatitis

Explanation:

3 0
3 years ago
The nutrien the nutrients needed in the human diet are ts needed in the human diet are
grin007 [14]
Carbohydrates
Proteins
Lipids
Water
Vitamins and minerals
4 0
3 years ago
45 POINTS IF CORRECT
katrin [286]

Answers

When doing medical research with human subjects, the following are unavoidable limitations;

It’s often impossible to repeat trials on the same subjects.

Subjects may report an inaccurate medical history.

It can be difficult to control all possible variables

There are ethical or privacy concerns to consider.

Explanation

When doing a medical research that involves human subjects it should be voluntary, informed and consent. The researchers should respect the persons treated as autonomous agents. The volunteers should be protected from physical, mental and emotional harm. The benefits should outweigh the costs.


4 0
3 years ago
Read 2 more answers
What did Marie Curie discover radium inside
pshichka [43]
Marie and Pierre Curie successfully isolate radioactive radium salts from the mineral pitchblende in their laboratory
5 0
3 years ago
Other questions:
  • All organisms perform _____, whether or not oxygen is present.
    11·1 answer
  • Animals are what that derive their energy from another organism A- autotorphs B- chemotrophs C- heterotrophs D- none of the abov
    9·1 answer
  • What can the dopper effect reveal about the movement of a star or galaxy
    13·1 answer
  • How do environmental factors and heredity affect personal health?
    8·2 answers
  • Balance the following chemical equation. CCl4 → C + Cl
    9·2 answers
  • Select all the correct answers.
    7·2 answers
  • What causes a movement between the land in the ocean
    14·1 answer
  • The graph below shows the distance traveled by four cars, A, B, C, and D, over a period of time.
    5·1 answer
  • Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first
    5·1 answer
  • Which biotic and abiotic factors are different between a lion and a deer?
    7·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!