1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Elena L [17]
3 years ago
5

PLEASE HELP!!!!!! NEED ASAP

Biology
1 answer:
77julia77 [94]3 years ago
8 0
When new evidence or a new way of thinking is brought up in regards to a specific matter, if said person isn’t willing to change their ways of thinking or it becomes very personal to them, they will have a difficult time changing with the times. This could possibly hold back new discoveries and halt new findings in the scientific community.
You might be interested in
I will give 5 stars, thanks and brainliest!! :)
irina [24]

Answer:

Explanation:

  • the drugs are first tested through human cells which then many of the substances fail this test
  • Then the drugs are then taken to animals for further testing
  • Once the test on animals is over, health voluteers then aid scientists or chemists in checking whether the drugs are good for humans or not
  • I REALLY HOPE THIS WAS USEFUL TO YOU
4 0
3 years ago
The __________ lobe contains the primary sensory cortex, which controls sensations such as touch or pressure
Mama L [17]
The parietal lobe contains the primary sensory cortex, which controls sensations such as touch or pressure.
7 0
3 years ago
8. The process that occurs only in the small intestine to increase the absorption of
Marina CMI [18]

Answer:

leleekkelele

Explanation:

e!!e!e!we!!eleel

e!e!elele

6 0
2 years ago
Mushrooms are usually considered part of the microbial world because their fungal hyphae are microscopic. Some mushrooms have a
Effectus [21]

Answer:

Basidiocarp

Explanation:

This is a multicellular structure found in mushroom that are visible to the naked eye and are spore producing. They are the structures of which spore producing basidia are formed. They called called false ruffles. The basidiocarps serve as the structure on which the hymenium is produced. They are the fruiting bodies of mushroom.

3 0
3 years ago
What is the mRNA sequence to match the DNA sequence below:<br><br> TACGCTCCATATCGCTAATCGCCGGATCAGATT
Kazeer [188]
AUGCGAGGUAUAGCGAUUAGCGGCCUAGUCUAA because A goes to U; T goes to A; G goes to C; C goes to G.
8 0
3 years ago
Read 2 more answers
Other questions:
  • When you are carrying a microscope, which of the actions listed below should you do? Check all that apply. Hold the arm with bot
    12·2 answers
  • Why is having an extra chromosome 21 tolerable to the point that someone with this condition can survive to maturity?
    11·1 answer
  • Which of the following best describes the difference between an adaptation and adapting? ​
    15·2 answers
  • Research with split-brain patients suggests that the ________ typically constructs the theories people offer to explain their ow
    11·1 answer
  • When you ask the question, “Has this author been cited in other resources?” which aspect of the Web resource are you evaluating?
    14·1 answer
  • Which equation is the slope-intercept from this equation
    13·1 answer
  • What are the smallest building blocks of life?
    5·2 answers
  • Which layer of bone is known as the "living skin?"*
    9·1 answer
  • How did Mendel’s experiments provide evidence for the principle of independent assortment?
    13·2 answers
  • Green plants,unlike animals can:
    7·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!