1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
matrenka [14]
3 years ago
14

Help me anyone who know this stuff

Health
1 answer:
Reil [10]3 years ago
4 0

it would be the hyoid bone

You might be interested in
Label the following activities as either aerobic fitness, anaerobic fitness, muscular strength, muscular endurance, or flexibili
vlada-n [284]

Answer:

           

Explanation:

Soccer -- aerobic

Wall sits -- anaerobic

Max lift bench press -- strength

Jogging -- aerobic

Sprinting -- anaerobic

Stretching -- flexibility

Planks -- both strength and endurance

Basketball -- aerobic

Squats -- anaerobic

Speed walking -- aerobic

Sit-ups -- anaerobic

Yoga -- flexibility

Swimming -- aerobic

Aerobic fitness -- it is an ability for our bodies to transport and use the oxygen, in order to produce the energy we need for our muscles. During aerobic fitness, our heart rate and breathing increase for some period of time.

Anaerobic fitness -- oxygen is not used. Compared to the aerobic fitness, it is more quick, more energy is used, and the maximum effort is performed, and it lasts shorter than aerobic fitness.

Flexibility  -- it includes stretching, yoga, Tai-Chi. It is good because it lengthens our muscles. It increases physical and mental relaxation, it prevents our bodies from injuries, reduces soreness.

Muscular strength -- it's occurring in a short period of time and the maximum of our strength is used. By definition, it is the amount of force a single muscle can produce with a single MAXIMAL effort.

Muscular endurance --  the word says it itself -- how much we can endure.

Compared to the strength, which is manifested in a short amount of time, but used to its maximum, in this type of exercise we are more focused on the enduring. It is muscle's ability to endure repeated action against a resistance for a certain amount of time.

6 0
4 years ago
How does the brain react to dopamine from pain medicine compared to naturally produced dopamine?
Harrizon [31]

Answer:

The brain builds up a tolerance to the drug and produces less dopamine when the person uses it, so they will have to use more and more of the drug to feel the same rush of dopamine as they did upon initial usage. Keep in mind that drugs can cause a release of two to ten times more dopamine than natural triggers like eating.

Explanation:

3 0
2 years ago
I neeeed hellpppppppppppp pleaseee
andrey2020 [161]

Answer:

physical violence, guilt trips, and controlling behavior

5 0
3 years ago
Read 2 more answers
An enzyme is used to unzip they dna 3'ACTGTACCCATGTGTACTGCCC 5' explication​
s2008m [1.1K]

Answer:

With an eye toward understanding DNA replication, Cornell researchers have learned how a helicase enzyme works to actually unzip the two strands of DNA. The results are published in the journal Nature. At the heart of many metabolic processes, including DNA replication, are enzymes called helicases.

Hope it helps?

Explanation:

5 0
3 years ago
On a cold day you will shiver. Explain how this response relates to homeostasis
Stolb23 [73]
When the homeostasis senses that your too cold, it sends signals to your muscles that make your shiver and create warmth. This is called maintaining the homeostasis.
3 0
3 years ago
Other questions:
  • Write a hypothesis about the effect of a strong odor on earthworm behavior. Use the "if . . . then . . .
    11·2 answers
  • A male is represented by a square in a pedigree. true or false
    14·2 answers
  • Sam has been smoking for years and finally wants to quit. his provider prescribes wellbutrin, a medication that binds nicotine r
    9·1 answer
  • How do you feel about this stressor
    5·2 answers
  • What are the best steps to take if you are dissatisfied with the health related product that you have purchased?
    15·1 answer
  • who knows the list of cancers that are not in need of chemothearpy. Or atleast some cancers. Just a thought.
    15·1 answer
  • We're no strangers to love
    11·2 answers
  • Joshua hit a stone wall while skateboard-
    9·1 answer
  • Is y'all brainly not working too I wanna ask a question but it won’t let me
    12·1 answer
  • A smoker is ____ to _____ times more likely to develop heart disease than a non-smoker.
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!