1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Minchanka [31]
3 years ago
9

Your body contains tens of thousands of different proteins, each with a specific structure and function. The unique three-dimens

ional shape of each of these diverse proteins is based on several superimposed levels of structure. Which of the following statements is an accurate description of proteins?
Biology
1 answer:
valkas [14]3 years ago
8 0

Answer:

Each protein with a specific structure and function

The unique three dimensional shape of proteins is based on several superimposed levels of structure

Explanation:

Proteins are essential nutrients for human and a vital source of fuel for building body tissues. They are made up of amino acids linked together by peptide bonds. These amino acids act as precursor to nucleic acids, hormones, immune, repair of tissues among others.

Proteins contain 20 amino acids which are the building block for proteins. These amino acids can be reformed to create millions of protein in human body in which each protein has specific structure and function.

The three dimensional arrangement of atoms in an amino acid chain is know as the protein structure. The precise shape formed determine the protein function.

You might be interested in
PLEASE I REALLY NEED HELP NOW!!!!!!
Mnenie [13.5K]
The genotypes would be 50% Bb and 50% bb
The phenotypes would be 50% brown and 50% white. Hope this helps :)
5 0
3 years ago
Bare rock
adoni [48]

Answer:

Primary Succession

Explanation:

Primary Succession is a barren area exposed by a retreating glacier

6 0
3 years ago
WILL GIVE A BRAINLEST
liberstina [14]
<span>Monoculture farming often results in reduced soil fertility</span>
7 0
3 years ago
Read 2 more answers
Nora, who is pregnant, wakes at 2am craving pickles. the craving indicates
Bogdan [553]
When women experience cravings for different foods, it means that they experiencing a hormone related change which severely effects their sense of taste and other senses that can cause these kinds of cravings.
let me know if you have any other questions
:)
8 0
3 years ago
The miller-urey experiment was important because it showed __________.
lapo4ka [179]
The Miller-Urey experiment is important because this was considered as the breakthrough in the study of origin of life, as to where and how exactly life began on earth and that it was possible to form organic molecules from inorganic molecules. 
8 0
3 years ago
Other questions:
  • What functions of the immune system is to
    12·1 answer
  • Ms. rudman, age 74, has no known health problems or diseases. you are doing a preventive health care history and examination. wh
    8·1 answer
  • Some autotrophic euglena species become ______ when light levels are low
    15·2 answers
  • Denaturation of Nucleic Acids A duplex DNA oligonu-cleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG ha
    15·1 answer
  • Can you match these prefixes suffixes and word roots with their definitions?
    5·2 answers
  • Carbohydrates and fats both...
    5·1 answer
  • The production of haploid(N) gametes is the main purpose of __________.
    12·1 answer
  • What are the four parts of a conclusion​
    12·1 answer
  • Given the controversy over drilling for oil as well as transporting oil, what is a viable option for the future?
    11·1 answer
  • How can evolutionary change in one species lead to evolutionary change in another species that it is associated with? Include an
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!