All categories

3 years ago

How do the prefixes endo- and exo- help you remember the definitions of the terms endocrine and exocrine?

Biology

2 answers:

Tasya [4]3 years ago

8 0

Answer: it shortened the name and easier to remember

Explanation:

meriva3 years ago

3 0

From endo-, you can shorten it to en, which will represent enter, as heat enters and is absorbed during this process.

And from exo-, you can also shorten it to ex, which will represent exit, as heat exits and leaves during this process.

NOTE: I truly apologize if my answer is incorrect. I still hope this helped! :) (a brainliest would be much appreciated!)

You might be interested in

Write a paragraph on testing probability

VashaNatasha [74]

Explanation:

Probabilities are described as ratios of favorable event outcome to the total number of event outcomes.

This is written as...

$P (E) =\frac{n(E)}{n(S)} \\$

where...

E= the number of times the event occurs

S= the number of trials

In biology experiments, hypotheses are formed based on research questions, and tested with the use of variables to provide a particular outcome. Statistics allows for testing data for consistency with the hypothesis, while statistical probability testing can be used in experiments to determine a range of outcomes, from genetic inheritance, evolutionary rates to theoretical experimental results.

In these statistical models, probability distributions are functions that give probabilities for certain event outcomes within an experiment (a set of trials). These may be either continuous, taking a value within a range of two numbers; or discrete, which may be either of two specified values. Discrete probability distributions list each value that a random variable may possibly take on.

Further Explanation:

For example, two types of probability distributions are employed in experimental biology:

Binomial distributions, which are discrete distributions, provide probability of a certain number of successful events for x a random variable, in a specific number of trials, n; here, the probability of success of an individual trial is constant at P and only one of two outcomes are possible- this is sampling with replacement.

where...

b(x; n, P)-the probability that an experiment of n trials results in x successes

nCx- the number of combinations of n things at r time

$b(x; n, P) = [ nCx ]* P^{x} * (1-P)^{n-x}\\$

<em>This is often used in determining potential outcomes before data collection.</em>

A type of continuous distribution, the student's t-test, compares standard deviations and means from two sets of samples or groups to check for significant differences between them.

$t= \frac{(x_{1} - x_{2}) }{\sqrt{(\frac{(S_{1}) ^{2} }{n1} }+ (\frac{(S_{2}) ^{2} }{n2 }}$

where...

x1 and s1 are the mean and standard deviation of sample 1 respectively
x2 and s2 are the mean and standard deviation of sample 1 respectively
n1 and n2 are sample sizes in samples 1 and 2 respectively

The null and alternate hypotheses typically theorize the likelihood and significance of certain event outcome probabilities. Critical values of t, along with degrees of freedom are used to determine a range of probable outcomes; probability or p- values along with this range, are used to determine whether either hypothesis is rejected or accepted.

<em>For instance, significant differences between an experimental control and a specific treatment group would show that these occurrences are not due to sampling errors or random chance...</em>

Learn more about calculating probability at brainly.com/question/4021035

Learn more about calculating event probability at brainly.com/question/6649771

#LearnWithBrainly

5 0

2 years ago

The large deposit of sand and soil formed at the end of a river is a

Karolina [17]

A large deposit of sand and soil formed at the end of a river is a delta. When a river empties into the ocean, the current carrying smaller particles, such as soil and sand, slows down and eventually stops, causing these particles to be dropped off on the shore. This eventually leads to a triangular deposit, usually referred to as the mouth of the river.

6 0

3 years ago

Please I urgently need help with this

Paul [167]

Answer:

A - Stigma

B - Anther

C - Filament

D - Style

E - Ovary

F - Petal

Explanation:

The above are the correct answers of the image drawn in the attachment.

These are parts of a flower.

A - Stigma: It is the head of the pistil. It contains a sticky substance that catches pollen grains from other pollinators.

B - Anther: This is the head of the stamen. It produces pollen grain.

C - Filament: It is a long slender part of the flower. It attaches the anther to the flower.

D - Style: It actually holds the stigma.

E - Ovary: It holds the ovule. Found at the base of the pistil.

F - Petal: It attracts pollinators to the flower.

8 0

3 years ago

If the two oligonucleotides are allowed to anneal and the DNA polymerase and all substrates (4 dNTPs, etc.) are added to the mix

Lorico [155]

Answer:

d. T

Explanation:

For a given DNA sequence, the array is represented as:

5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'

And the premier; 5' GGACCTGTGA 3' attaches to the complementary base on the DNA sequence.

i.e.

5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'

*AGTGTCCAGG

Thus, the first nucleotide that will be incorporated into the DNA will be T

5 0

2 years ago

Until the onset of _________, humans cannot produce active reproductive cells.

vredina [299]

(A)Until the onset of PUBERTY,

6 0

2 years ago