1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Natasha_Volkova [10]
3 years ago
15

why are you allowed to use the coarse adjustment when you focus the low power objective lens but not when you focus the high pow

er objective lens?
Biology
1 answer:
FinnZ [79.3K]3 years ago
8 0
Because you will focus past ("overshoot") your specimen. (Like using a race car as a shopping cart: it's too fast, and you'll fly past the cereal and never even see it before you realize you need to stop.) Also: you risk crushing the slide and objective against each other (on older or cheaper scopes), and that would be a costly (and embarrassing) mistake.
You might be interested in
What factors can affect an organisms trait
Artemon [7]

Answer:

Environmental factors such as diet, temperature, oxygen levels, humidity, light cycles, and the presence of mutagens can all impact which of an animal's genes are expressed, which ultimately affects the animal's phenotype.

Explanation:

3 0
2 years ago
This is the "Passage" from the last question I posted :)
podryga [215]

Answer:

-

Explanation:

3 0
3 years ago
Read 2 more answers
Why is it important for geologists to use both relative and absolute ages to determine the age of rocks?
uysha [10]

Answer:

to help and determine the exact age of the rocks

Explanation:

The study of rocks strata is known as stratigraphy. It is useful and helps the scientist and the researcher to study the earth's crust and its past.

Scientist could age the rock using two methods. They are :

Relative ages

Absolute ages

Early scientist could determine the exact age of the rock of the earth's crust. They use to find the relative ages of the layers of the rocks and then determine how one rock layer is older or younger than the other. But with advancement and development of carbon dating, scientist could tell the exact age of the rocks found on the earth's crust.

The Scientists uses the relative as well as the absolute dating technique to date the rock layers. They organize the rock layers based on their age and scale from the oldest to the youngest on a geologic time scale. So an exact date of the rocks can be determine by using the two methods of relative age and the absolute age.

3 0
2 years ago
How did life begin?
Feliz [49]

Explanation:

Many scientists believe that RNA, or something similar to RNA, was the first molecule on Earth to self-replicate and begin the process of evolution that led to more advanced forms of life, including human beings.

The main causes of climate change are: Humanity's increased use of fossil fuels – such as coal, oil and gas to generate electricity, run cars and other forms of transport, and power manufacturing and industry. Deforestation

Volcanologists can predict eruptions—if they have a thorough understanding of a volcano's eruptive history, if they can install the proper instrumentation on a volcano well in advance of an eruption, and if they can continuously monitor and adequately interpret data coming from that equipment.

6 0
3 years ago
Mercury is 0.39 AU from the sun. What is its distance from the sun in kilometers?
nignag [31]
Mercury is 46 million kilometers away from the sun
7 0
3 years ago
Other questions:
  • Which assessment finding in the pregnant woman at 12 weeks' gestation should the nurse find most concerning? the inability to:?
    6·1 answer
  • Multicellular organisms _____ genetic information and mix the information from both parents
    13·1 answer
  • What is a biotic factor in a coral reef ecosystem?
    10·2 answers
  • ___Na + ___ Cl2 -------> 4 NaCl
    12·1 answer
  • The presence of gill-like slits in a human embryo is considered to be evidence for the
    15·1 answer
  • Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequ
    11·1 answer
  • What contributes to cell membrane fluidity? Proteins and lipids exist as separate but loosely attached molecules that can move a
    12·1 answer
  • In digestion why do some food molecules decrease by the same amount that others increase.
    11·2 answers
  • PLZ HELP WILL GIVE BRAINLIST
    10·1 answer
  • What trait is recessive in the picture
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!