1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
xeze [42]
3 years ago
13

A geneticist crossed pure breeding black mice with pure breeding brown mice. All the 992 mice in F1 generation had black coats.

When these mice were crossed, the yielded 961 black coated mice and 317 brown coated mice. How could you account for the ratio of black coated to brown coated mice in the F2 generation?
Biology
1 answer:
lana66690 [7]3 years ago
5 0

Answer/Explanation:

The pure breeding (homozygous) black mice are crossed with pure breeding (homozygous) brown mice. The F1 offspring are all black. A punnett square is shown, with B representing the black allele, and b representing the brown allele. The cross is therefore BB x bb

The offspring are 100% heterozygous black (Bb)

Crossing two F1 heterozygous black mice (Bb x Bb) to give the F2 generation. The genotypes are 1 BB: 2 Bb: 1 bb. Therefore, the genotypes are 3 black : 1 brown.

This accounts for the real ratios shown in the F2 generation (992:317 is roughly 3:1

Download pdf
You might be interested in
What's the elements of iron​
Nitella [24]

Answer:

Fe

Explanation:

Iron is a chemical element with symbol Fe and atomic number 26. It is a metal that belongs to the first transition series and group 8 of the periodic table. It is, by mass, the most common element on Earth, right in front of oxygen, forming much of Earth's outer and inner core

7 0
2 years ago
Summarize how a freshwater ecosystem, such as a pond, can change into a terrestrial ecosystem.​
juin [17]

Answer:

how a freshwater ecosystem, such as a pond, can change into a terrestrial ecosystem.​how a freshwater ecosystem, such as a pond, can change into a terrestrial ecosystem.​how a freshwater ecosystem, such as a pond, can change into a terrestrial ecosystem.​how a freshwater ecosystem, such as a pond, can change into a terrestrial ecosystem.​

Explanation:

6 0
3 years ago
40 POINTS! NEED ANSWER QUICK!
eduard
If i was u i would look it up thats what i would do

7 0
3 years ago
Read 2 more answers
Which statement describes a shield volcano?
olga_2 [115]
A)formed from repeated non-explosive eruptions of flowing lava
7 0
3 years ago
1. What changes in the nucleus during alpha decay?
stepan [7]

Answer:

Mass Number and Atomic Number

Explanation:

Alpha decay or α-decay is a type of radioactive decay in which an atomic nucleus emits an alpha particle and thereby transforms or 'decays' into a different atomic nucleus, with a mass number that is reduced by four and an atomic number that is reduced by two.

3 0
3 years ago
Other questions:
  • How the conditions on early earth made the origin of life possible?
    8·1 answer
  • Digestive system immune response
    11·1 answer
  • What should the food handler do before touching the chicken lettuce tomato and bun?
    14·1 answer
  • A population is a population is a group of individuals of the same species that live in the same area and interbreed. all indivi
    15·1 answer
  • Please answer this question
    7·1 answer
  • Denaturation of Nucleic Acids A duplex DNA oligonu-cleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG ha
    15·1 answer
  • What specific protein can be made from amino acids?
    11·2 answers
  • What is the primary role of decomposers in an ecosystem A.
    8·2 answers
  • Please help.. due tonight 10 points Will mark Brain
    9·1 answer
  • Helppppppp please kshshshshshsh with science i dislike it smmmmmm​
    10·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!