1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Mars2501 [29]
3 years ago
5

Which of the following is not a disease that is associated with a defect in a DNA repair pathway?

Biology
1 answer:
Sunny_sXe [5.5K]3 years ago
7 0
A is the best answer
I hope it’s work
You might be interested in
A certain segment of DNA can be used as a molecular clock. Its rate of mutation is one mutation per 20 million years. Examine th
IgorC [24]
Let's calculate the difference in nucleotides. The number of difference multiplied by rate of mutations will help to determine how long ago these two species shared a common ancestor.

Species A: GTACCTAAGTTCACCGAATT
Species B: GAACCTAAGGGCACCGAACT

These species differ in 4 nucleotides.
This number should be multiplied <span>by </span>the rate of mutations
5 0
3 years ago
How does teaching the public about energy conservation help decrease alr
Amanda [17]

Answer:

I think you answered your question but if not A

Explanation:

All the other answers are just dumb

6 0
3 years ago
All the plants and animals in the world are made of
Oksi-84 [34.3K]

Answer:

made out of cellls

Explanation:

6 0
3 years ago
If the pride is taken over by new individuals, what happens to the females? males? cubs?.
Nookie1986 [14]

The cubs are a significant barrier to reproduction when a new male coalition first takes control of a pride. Mothers of surviving cubs won't mate again until their young are at least 18 months old, but if their cubs are lost, they will mate right away.

  • Following that, males leave on their own or are driven out by other men who take control of their pride. It is common for a new male to kill all the cubs when he joins the pride in order to pass his genes on to all future cubs. The major function of males in the pride is defending the pride's territory.
  • Female lionesses will devour the cubs of other pride, but not the cubs of their own pride. The "egalitarianism" of female lions stands in stark contrast to the autocratic behavior of wolves, wild dogs, and several other species, where dominant females prevent subordinates from reproducing.
  • When a female lion gives birth, she leaves the pride and doesn't come back until the cubs are several weeks old. After that, the adult females band together to take care of and protect the young.

Learn more about pride here:

brainly.com/question/17454996

#SPJ4

6 0
1 year ago
BRAINLIESTTT ASAP!!! PLEASE ANSWER :)
valkas [14]

your answer is the third one.

Usually representing a solid you used a 3d model.

And there are balls in them representing atoms and in a video it shakes or vibrates to represent the motions of a solid.

3 0
3 years ago
Read 2 more answers
Other questions:
  • Classify each item as being associated with light positioning (controlling how and where light strikes the retina) or sensory pr
    5·1 answer
  • What city does sunrise occurs in first each day??
    14·1 answer
  • Determine if the two figures are congruent and explain your answer.
    9·1 answer
  • The poison dart frog can have bright green, red, blue, or yellow skin that secretes a poisonous substance when it feels threaten
    14·2 answers
  • What connects neurons?
    8·2 answers
  • Please help need help to pass my class plz
    10·1 answer
  • Many farmers and gardeners compost their plant and animal waste. The living material naturally decays in compost bins, forming a
    6·2 answers
  • Which of the following terms describes all of the non-living components of an ecosystem?
    10·1 answer
  • Please put in order for a food chain.
    7·1 answer
  • You carry out a self-cross of the offspring produced from a cross between homozygous pea plants with yellow and green seeds. You
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!