Explanation:
Translation is the process by which a polypeptide is polymerized from genetic information.
Firstly we have to make a transcription from the coding DNA strand to a single RNA strand (mRNA). RNA pol reads from 5' to 3' of the template strand and nucleotides are added by complementarity ( Adenine with Uracil, Thymine with Adenine and Cytosine with Guanine, Guanine with Cytosine).
DNA: 5'- CGTTATGTGGACTCTCTGGTATGACTCACCTTAT -3'
mRNA: 5'-GCAAUACACCUGAGAGACCAUACUGAGUGGAAUA -3'
mRNA goes to the ribosomes where translation takes place. The enzyme will read every three letters (codon) starting at the start codon sequence (TAC in DNA, AUG in mRNA). According to codons tRNA carrying the amino acids will place it (by complementary to their anticodon) and the enzyme will join it to the nascent polypeptide or protein.
In order to do this we need to look up the genetic code and assign the proper amino acids.
Unfortunately the given strand does not have a start codon TAC codifying for initial methionine.
Answer: Stoichiometry is the process of comparing the individual qualitative or numerical variables of the reactants or products involved in a chemical reaction.
Explanation:
The answer is:
A. The reaction between A and B is reactant favored
Explanation:
Because the reaction favors reactants, their concentration will be higher at equilibrium than the products.
Answer:
Compared to early humans our brains seemed to have increased in size, and part of the cause may be because of things like Climage change, ecology and social competition
Explanation:
Mitosis produces two diploid (2n) somatic cells that are genetically identical to each other and the original parent cell, whereas meiosis produces four haploid (n) gametes that are genetically unique from each other and the original parent (germ) cell.
