What happens when an electron falls to a lower energy level?

Guess how many water molecules self-ionize in one liter of water! a) 7 moles b) 1 mole c) 10,000,000 moles d) 0.0000001 moles

Rudiy27

Answer:

D)

Explanation:

This seems like a weird question

Water is held together by covalent bonds. The amount of energy required to break these bonds so that water would split into it's respective ions is pretty high. The chances that any one of the molecules floating in 1L of water get enough energy to spontaneously burst into it's ions is slim to none.

So, D) seems like the most likely answer

6 0

2 years ago

If 0.138g of cyclohexene (c6h10) was obtained from 0.240g of cyclohexanol (c6h120), what is the percentage yield of cyclohexene?

tino4ka555 [31]

<span>Given in the question- 1 mole of cyclohexanol = > 1 mole of cyclohexene Molar mass 100.16 g/mol moles of cyclohexanol = .240 / 100.16= 0.002396 moles Molar mass 82.143 g/mol moles of cyclohexene formed @100 % yield = 0.002396 Molar mass 82.143 g/mol mass of cyclohexene @ 100 % = .002396 x 82.143 = 0.197g bur we have .138g so % yield = .138 / .197 = 70.0 % Ans- 70 percentage yield of cyclohexene.</span>

4 0

3 years ago

Chose the two factors that work together to create the global wind patterns that operate in the atmosphere.

grin007 [14]

Global wind patterns are mainly determined by unequal heating of the earth's surface, changes in air pressure, and earth's rotation. Change in air pressure: Air mainly circulates due to change in air pressure. It moves from a region of high air pressure to the region of lower air pressure.

3 0

2 years ago

DNA transcription-to-translation # 1 Homework Unanswered Due in 4 days Given the following sequence of the coding strand, writte

uysha [10]

Explanation:

Translation is the process by which a polypeptide is polymerized from genetic information.

Firstly we have to make a transcription from the coding DNA strand to a single RNA strand (mRNA). RNA pol reads from 5' to 3' of the template strand and nucleotides are added by complementarity ( Adenine with Uracil, Thymine with Adenine and Cytosine with Guanine, Guanine with Cytosine).

DNA: 5'- CGTTATGTGGACTCTCTGGTATGACTCACCTTAT -3'

mRNA: 5'-GCAAUACACCUGAGAGACCAUACUGAGUGGAAUA -3'

mRNA goes to the ribosomes where translation takes place. The enzyme will read every three letters (codon) starting at the start codon sequence (TAC in DNA, AUG in mRNA). According to codons tRNA carrying the amino acids will place it (by complementary to their anticodon) and the enzyme will join it to the nascent polypeptide or protein.

In order to do this we need to look up the genetic code and assign the proper amino acids.

Unfortunately the given strand does not have a start codon TAC codifying for initial methionine.

3 0

3 years ago

Express 1123 pg in nanograms.

Strike441 [17]

1.123 nano-grams is your answer, do you understand now gimme dat 5 star and brainiest

5 0

3 years ago