1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Andreas93 [3]
3 years ago
7

What is the formula for Phosphate?

Chemistry
2 answers:
swat323 years ago
7 0

Answer: PO43-

You welcome

krek1111 [17]3 years ago
5 0
<span>PO43- is the formula of phosphate. 

Answer: PO43-</span>
You might be interested in
Given the following Babnced equation 4NH3 +5O2&gt;
igor_vitrenko [27]
4NH3 + 5O2 ==> 4NO + 6H2O Balanced equation
ALWAYS WORK IN MOLES, NOT IN GRAMS
moles of NO produced = 70.5 g NO x 1 mole/30 g = 2.35 moles NO
Since this represents only a 29.8% yield, find what 100% yield would be:
2.35 moles/0.298 = 7.89 moles of NO
From the balanced equation 4 moles NH3 produces 4 moles of NO. Calculate moles of NH3 needed:
7.89 moles NO x 4 moles NH3/4 moles NO = 7.89 moles NH3 needed
Find grams of NH3 needed:
7.89 moles NH3 x 17 g/mole = 134 g NH3 needed
8 0
3 years ago
5. How can you tell the difference between CuS and Cu2S
Oxana [17]
Prominent copper sulfide minerals include Cu2S (chalcocite) and CuS (covellite).
8 0
4 years ago
Write uses of Co-60 .​
ivolga24 [154]

Answer:

Cobalt Sources

Cobalt-60 is used as a radiation source in many common industrial applications, such as in leveling devices and thickness gauges. It is also used for radiation therapy in hospitals. Accidental exposures may occur as the result of loss or improper disposal of medical and industrial radiation sources.

Explanation:

4 0
3 years ago
Read 2 more answers
The gas in a cylinder has a volume of 8 liters at a pressure of 101 kPa. The pressure of the gas is increased to 206 kPa. Assumi
Arlecino [84]
The pressure of the gas is increased<span> to 224 </span><span>kPa</span>
3 0
3 years ago
A chemical reaction involves reactant species A, B, and C. Leaving all other factors identical, doubling the concentration of sp
umka21 [38]

Answer:

Rate = k . [B]² . [C]

Explanation:

The dependence of the reaction rate on the concentration of the reactants is given by the reaction order of each one, as shown in the rate equation.

Rate=k.[A]^{x} .[B]^{y} .[C]^{z}

where,

k is the rate constant

x, y, z are the reaction orders.

  • <em>The rate of reaction is not affected by changing the concentration of species A.</em> This means that the reaction order for A is x = 0 since when its concentration changes, the rate stays the same.
  • <em>Leaving all other factors identical, doubling the concentration of species B increases the rate by a factor of 4.</em> This means that the reaction order for B is y = 2, so when the concentration is doubled, the new rate is 2² = 4 times the initial rate.
  • The rate of the reaction is linearly dependent on the concentration of C. This means that the reaction order for C is z = 1, that is, a linear dependence.

All in all, the rate equation is:

Rate = k . [B]² . [C]

3 0
3 years ago
Other questions:
  • Determine the pH of a solution made by diluting 25mL of 6.0 M HCl until the final volume of the solution is 1.75 L
    10·1 answer
  • What is the complementary DNA strand for the following sequence:<br> ATGGCTTGCCAAGGTCCGGAAACTTTG
    7·1 answer
  • The following balanced equation shows the formation of water.
    14·2 answers
  • which analogy best represents a supersaturated solution? an empty elevator that has a maximum load of 20 people a single person
    15·2 answers
  • Which of the following is the correct Lewis structure diagram for Neon? (2 points)
    11·1 answer
  • What happens in a double-replacement reaction?
    5·2 answers
  • A student dissolves of glucose in of a solvent with a density of . The student notices that the volume of the solvent does not c
    14·1 answer
  • Identify the phase of matter based the image of the substance below
    15·1 answer
  • Please help me
    10·2 answers
  • the carbon canisters are about the size of a 55-gallon drum, how often would replacement be required?
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!