1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Alex73 [517]
2 years ago
11

10 points

Biology
2 answers:
kramer2 years ago
5 0
Carbon is the correct awncer
SVEN [57.7K]2 years ago
4 0
Answer:
Carbon

Explanation:
Carbon is a basic building block for life. All living organisms contain carbon.
You might be interested in
1. Describe the possible mechanisms whereby exercise may enhance health status and list at least eight of the potential health b
Gala2k [10]

Answe

Explanation:

Excersice increases the cardiac and skeletal muscels strenght for maximum oxygen consumption for energy output.

It lowers the blood pressure and in prove RBC count for oxygen transportation and distribution.

It cut down risk of osteoporosis, by stimulating bone growth.

5 0
2 years ago
Some algae demonstrate the phenomenon of alternation of generations, in which a multicellular, diploid, spore-producing organism
Leto [7]

Answer:

Option c. Only the haploid organism may also reproduce asexually.

Explanation:

It is scientifically approved that algae and fungi are able to form true asexual spores. This process of spore formation involves mitosis and resultant spore is called mito-spore which develop into new offspring.

Reference: Smith, B. A., and DANIEL D. Burke. "Evidence for the presence of messenger ribonucleic acid in Allomyces macrogynus mitospores." Journal of bacteriology 138.2 (1979): 535-541.

3 0
3 years ago
Can someone please help me
Usimov [2.4K]

Answer:

1A - Respiratory = trachea, lungs... however both arteries and veins move oxygen around the body, and are therefore valid answers

1B - Skeletal = bones

1C - Muscular = muscles

1D - Digestive = stomach, large/small intestine

1E - Circulatory = heart, veins and arteries

2. Cellular respiration is the conversion of sugar into energy the cell uses to function via various chemical reactions. Digestion is an example of this. Stomach acid breaks down food into sugars that cells break down further into energy to keep you alive

3. Bones contain bone marrow deep inside of them which is responsible for the creation of red blood cells. Your lungs can move air all they want but would be useless without red blood cells to take the oxygen to cells and take the CO2 away from them.

5 0
2 years ago
How many potted plants should they be able to produce on day 3?.
kiruha [24]

Answer: 50

Explanation:

Venya and Kari own a flower shop that specializes in custom bouquets. Wanting to expand into selling potted plants, they create a production possibility chart to asses whether the potted plants are a good idea. Study their chart: 50

i just took a test on this.

8 0
2 years ago
Read 2 more answers
Please help me with this I set the points to the highest it could be. Please help!! The problem is shown in the picture!
Triss [41]

Answer:

I believe it would be the first option

4 0
3 years ago
Other questions:
  • Historically, wildfires were viewed as detrimental to forest ecosystems
    14·2 answers
  • Which describes one of the ways proteins behave in facilitated diffusion?
    12·2 answers
  • Neutrophils are the most abundant phagocytic cells. how do they differ from other phagocytic cells?
    7·1 answer
  • A. True <br> b. False: decision structures are also known as selection structures.
    8·1 answer
  • Give a example of a mutation that is beneficial and a general explanation of how it is so
    6·1 answer
  • What would be the complementary strand for the following DNA sequence 5' GACATACCCAGACGGTATATTGA 3'
    8·1 answer
  • The earth's magnetic field is associated with the:
    12·1 answer
  • Most crimes involve some evidence relating to the human body; for that reason, what related science is frequently used in forens
    10·1 answer
  • There is a population of moths that have a variety of colors in the same population.
    7·1 answer
  • List 7 ways to solicit for assistance of government in environmental sanitation.​
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!