1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Komok [63]
3 years ago
10

Based on the climograph of six specific biomes illustrated here, which of the following shifts in biomes and their specific ecos

ystems would be most likely to result if global climate change continues to lead to a warmer Earth?A. Coniferous forest to temperate forestB. Grassland to tundraC. Coniferous forest to tundraD. Tropical forest to temperate forest
Biology
1 answer:
MatroZZZ [7]3 years ago
7 0
The answer is A. Coniferous forest
to temperate forest
You might be interested in
Jimmy finds a hunk of something. It appears to be an element. It melts at 500*C and when it was run over by a train, it got crus
Yanka [14]

Answer:

Metalloid

Explanation:

It is metalloid

4 0
3 years ago
A combination of DNA and protein molecules that exists in a loose, web-like form is known as ________.
algol [13]

Answer:

The answer is Chromosomes

6 0
3 years ago
Write the tRNA sequence for the given strand of mRNA<br> AGGUCAUGCAUGGGCAUGCAU
coldgirl [10]

Answer:

Your understandable!

Explanation:

The words you've used are unreadable!

4 0
3 years ago
Where do you think that other atoms come from
ivann1987 [24]

Answer: atoms come from originally....The first source was the BIG BANG that created the Universe 14 billion years ago. When the big bang occurred, the elementary particles initially were too hot initially to make any stable atoms... but after a few thousand years, when things cooled down a lot, Hydrogen and Helium got made.

4 0
3 years ago
True/False: A scientist uses a control in an experiment to show that the results of the experiment are actually due to the condi
Andrew [12]

Answer:

true

Explanation:

this helps them prove there tests out

4 0
3 years ago
Read 2 more answers
Other questions:
  • Create a bottom strand that complements to the strand above. ORIGINAL TOP STRAND
    12·1 answer
  • Why are common names not a good reference to a species
    6·1 answer
  • Were there any problems with Robert Hooke's work or their understanding of cells?
    6·1 answer
  • What process occurs to in the first stage of celluar respiration
    7·2 answers
  • Aquatic ecosystems are governed by factors such as amount of oxygen, amount of light, and water movement.
    15·1 answer
  • Which genetic variation is shown below?
    13·1 answer
  • Which of the following organisms are the only examples of prokaryote?
    15·2 answers
  • Choose one biogeochemical cycle and explain.
    14·1 answer
  • Question 10 of 10
    6·2 answers
  • Explain why studying microorganisms such as bacteria can help scientists understand how evolution works.
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!