1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
saveliy_v [14]
3 years ago
14

Which is the function of bone?Select one of the options below as your answer: A. Production of muscle cells B. Production of blo

od cells C. Production of nerve cells
Biology
2 answers:
Serggg [28]3 years ago
6 0
Bone marrow is the organ in the body responsible for B. Production of blood cells. It is a tissue found internally of bones. The p<span>rogenitor </span>cell<span> also called stem </span>cell<span> are found in the </span>bone marrow<span> which are responsible to produce new </span>blood cells<span> and stromal </span>cells<span>.</span>
Anna71 [15]3 years ago
5 0

Bones produce blood cells. The red bone marrow found in the connective tissue of certain bones is the site of blood cell production. The correct answer between all the choices given is the second choice or letter B. I am hoping that this answer has satisfied your query and it will be able to help you in your endeavor, and if you would like, feel free to ask another question.

You might be interested in
The rusty crayfish is harmful to native species of crayfish because it clear cuts the bottom of waterways leaving native species
BARSIC [14]
This would be true. the rust cray fish is an aggressive type that competes for food
3 0
3 years ago
Read 2 more answers
Where is the largest reservoir of carbon?
choli [55]
The largest reservoir of carbon is in the ocean
8 0
3 years ago
Please help I really would appreciate it
vekshin1

Answer:

Light, electric

Explanation:

4 0
3 years ago
- Explain why the concept of evolution is a Scientific Theory.
Anni [7]

Answer:

The theory of evolution basically serves to explain the biological evolution of living beings. The theory of evolution basically serves to explain the biological evolution of living beings. This results in the appearance of new species different from the previous ones.

6 0
3 years ago
Read 2 more answers
Which of the following would you least likely find living in the chaparral biome?
EastWind [94]
B. Pine trees, this is the answer that was right after I took the test XD

8 0
3 years ago
Read 2 more answers
Other questions:
  • Which condition is considered progressive rather than reversible?
    15·1 answer
  • Two atoms that are isotopes of one another must have the same number of what? Electrons, All Particles, Protons, or Neutrons
    14·2 answers
  • (2
    8·1 answer
  • _____ is an unpleasant side effect that alcohol withdrawal creates for an alcoholic. excessive sleepiness leptokurtic reaction c
    9·1 answer
  • Which of the following organelles would NOT be found in an animal cell
    15·2 answers
  • Which of the following is a direct interspecific interaction?
    7·1 answer
  • Both plants and animals share two broad characteristics of what?
    12·1 answer
  • 1. Describe at least two experiments and discuss how they helped determine that DNA and not protein was the hereditary material.
    5·1 answer
  • Need mRNA <br> AMINO ACIDS <br> 1.AATACGGGGGCGTAACCACTA<br> 2. GCTAGTACGTGCACATTAGAA
    5·1 answer
  • Giving brainliest , only number one pls
    10·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!