1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Inessa05 [86]
3 years ago
12

Here are four amendments to the Constitution about who can vote. Describe one of them.

Law
1 answer:
Anvisha [2.4K]3 years ago
7 0

Answer:

Citizens eighteen (18) and older can vote.

Explanation:

Yes, according to the Constitution the citizen who is 18 or older has the right to vote!

Hope it helps!

You might be interested in
Which of the following terms refer to the area of law that defines the relationship between the federal government and state gov
Andrews [41]

Federalism.

You did not provide the "following terms", but federalism refers to the relationship between federal & state governments.

3 0
3 years ago
QUESTION 1 What type of approach do Sgt. Evans and Lee the intern take in solving the issue of the robbery attempts on a targete
anastassius [24]

Answer:

C. Tooth and Nails Approach

Explanation:

The type of approach Sgt. Evans and Lee the intern take in solving the issue of the robbery attempts on a targeted ATM is Tooth and Nails Approach.

The process involves analyzing data.

7 0
3 years ago
The devastation caused by alcoholic beverages is most noticeable on its effects on families.
aalyn [17]

Answer: true

Explanation:

5 0
2 years ago
Read 2 more answers
PLEASE HELP ASAP!! GO TO MY OTHER QUESTIONS PLZ...Colored fluids found under your engine are not a sign of a serious problem.
algol [13]

Answer:

FALSE

Explanation:

EDGIN 2020

6 0
3 years ago
hi i am loney who wants to be my fried if you do please give me you phone numder but you hve to be 13 and 12 or 11
Radda [10]

Answer:

I am sorry that I am not your age.... hope you get friends.. and your not lonely to anymore.. Have a good day!!

8 0
2 years ago
Other questions:
  • Elin contracts to buy six cases of vintage Fertile Valley wine from Grapes & Vines Winery for $1,200. The contract states th
    5·1 answer
  • Which legislative power is expressed in Article I of the U.S. Constitution?
    7·1 answer
  • How many repeats are there for this STR? Refer to the following DNA sequence to answer the questions: CTAGAAGCTTAAAGCTTCATCATCAT
    15·1 answer
  • Which of the following adjectives BEST describes an effectual, and true
    6·1 answer
  • What are ultimate laws?
    11·1 answer
  • What if you were a jury member in a case in which a 25-year old professional wrestler is charged with 2nd degree murder for shoo
    12·1 answer
  • A pleading filed by one party to dismiss the other party's pleading for failing to state a cause of action is known as _________
    10·1 answer
  • What do we call the study of the ways in which money is created and used in society?
    12·2 answers
  • Who's against gun control laws?
    8·1 answer
  • The ideas and philosophies that explain the origin of law and its justification are called __________. Multiple Choice stare dec
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!