1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Pani-rosa [81]
3 years ago
10

A shoe box in the shape of a rectangular prism has a length of 12 inches, a width of 6 1/2 inches, and a height of 4 1/2 inches.

Mathematics
1 answer:
katovenus [111]3 years ago
3 0
12 x 6 1/2 x 4 1/2 = 351in^3
You might be interested in
A line with a slope of - 8 passes through the points ( - 1, z) and ( - 2, 7). What is the value of z?
ikadub [295]

Answer:

z = -1

Step-by-step explanation:

7 - z / -2 - (-1)

7 - z / -2+1

7 - z / -1

-7 +z = -8

z = -1

to check the work

(-1,-1) (-2,7)

7 + 1 / -2 + 1

8 / -1

= -8

4 0
3 years ago
Spends at most 30, buys boxes of crayons that cost 2 per box, also buys a poster for 5. Wants to know how many boxes of crayons
My name is Ann [436]

Answer:

for 15 crayons box she can spend

Step-by-step explanation:

The computation of the number of crayons for which she can spend is shown below:

Given that

She can spend $30

And, the cost is 2 per box

So, for the number of crayons for which she can spend is

= $30 ÷ 2

= 15 crayons box

Hence, for 15 crayons box she can spend

The same would be relevant

4 0
3 years ago
What is -7x=19 as a fraction?
wlad13 [49]

Answer:

x= -19/7

Step-by-step explanation:

-7x/-7=19/-7

7x/7=19/-7

8 0
3 years ago
Read 2 more answers
Please help me out, i’ll mark brainliest!!
Novay_Z [31]
College............................
4 0
2 years ago
you have 28 dog biscuit. You have 8 dog bowls. Each dog bow gets the same number of biscuits. how many biscuit are left over?
bearhunter [10]
First you want to find a multiple that's very close to 28. It's 24, so subtract 28-24 which is 4. 4 biscuits are left. 

Hope that helped:)

5 0
2 years ago
Read 2 more answers
Other questions:
  • Check
    9·1 answer
  • What is the sum of the solution of 2lx-1l-4=-2
    15·2 answers
  • Write the trigonometric expression as an algebraic expression in u. cos (sin-1 u)
    6·1 answer
  • 6x-y=8<br> 7x-y=9<br> Solve linear systems by Multiplying first
    9·1 answer
  • Suzanne is 64 inches tall what is the height in feet and inches
    13·1 answer
  • What is the complementary DNA strand for the DNA strand<br> AATTGGCCATGCATGATTACGA
    7·2 answers
  • Urgent!! Math!! What’s the answer to 1,2,3?
    10·1 answer
  • Write an equation for the quadratic graphed below
    11·2 answers
  • What is the surface area of this rectangular pyramid?
    11·1 answer
  • <img src="https://tex.z-dn.net/?f=%5Csqrt%7B13%5E%7B2%7D%20%7D%20-12%5E%7B2%7D" id="TexFormula1" title="\sqrt{13^{2} } -12^{2}"
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!