1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Anika [276]
3 years ago
15

) You treat some cells with a proteolytic enzyme that is too large to penetrate the cell membrane (Set 1). Another group of cell

s is made permeable before treatment with the enzyme (Set 2). A third set of cells was not treated with the enzyme at all (controls). Proteins are then extracted from the three different sets of cells and applied to an SDS-PAGE gel. Protein W migrates to the same distance on a gel of proteins from Set 1 and Set 2; Protein W migrates a shorter distance on gels of proteins extracted from the control group than on gels of proteins extracted from Set 1 and Set 2 treated cells. Protein X migrates to the same distance on a gel of proteins from control cells and the gels of the proteins from Set 1 and Set 2. Protein Y migrates a longer distance when extracted from Set 1 cells than does protein Y in the controls; Protein Y moves an even larger distance in the gel of the extracts from Set 2. Protein Z migrates the same distance on gels of proteins from the controls and the proteins extracted from Set 1, but it migrates a longer distance in extracts from Set 2 cells. Which protein is exposed only on the exterior of the cell?
Biology
1 answer:
Advocard [28]3 years ago
3 0

Answer:

Proten W

Explanation:

SDS-PAGE gel is a method used for the separation of proteins in which proteins are separated based on their length (smaller proteins move faster through the gel, due to less resistance).

When treated with proteolytic enzymes, proteins are cut and become short fragment. This means that the fragments formed after the use of proteolytic enzymes, will move faster and thus, migrate a longer distance. Proteolytic enzymes in Set 2 cells will act only on plasma membrane proteins (because they cannot penetrate), while in Set 2 they will act on both, plasma membrane and interior proteins. Control group will have only the large fragments (not treated with enzyme).

Protein W travels the same distance on a gel of proteins from Set 1 and Set 2, but different than control group. It means that the proteolytic enzyme worked the same on Set 1 and Set 2.

You might be interested in
Enter the sequence of the DNA coding strand with a 5-3 polarity. DO NOT WRITE 5 OR 3 OR 5' OR 3' IN THE BOX!
Charra [1.4K]

Complete question:

Use the sequence below to answer the following questions  

3’-ACGGATCCTCCCTAGTGCGTAATACG-5’  

5’-TGCCTAGGAGGGATCACGCATTATGC-3’  

1. Enter the sequence of the coding strand with a 5’-3’ polarity

Answer:

coding strand → 5´- GCATAATGCGTGATCCCTAGGCA -3´

Explanation:

When referring to the <u>coding strand</u>, we are talking about the sequence that turns to be the same as the mRNA that results from the transcription of the same DNI segment -switching bases T for U-.  

The coding strand receives that name because it is the sequence that codes for each amino acid composing the proteins.

When the DNI molecule separates into two strands to form the transcription bubble, we can identify two separate segments: coding strand and template strand.  

The coding strand goes in direction 5´ to 3´, while the complementary strand -template strand- grows in direction 3´ to 5´.  

Whenever we have a DNI molecule and we need to determine which strand is the coding one, we just need to look for the presence/absence of start or stop codons.

So, in the exposed example we have two strands, but we do not know yet which one is the coding one.

Conventionally, the first strand is always the coding one. However, let us analyze it by using the presence/absence of codons.

First-strand:

3’-ACGGATCCTCCCTAGTGCGTAATACG-5’

let us write it is 5´to 3´direction

5´- GCATAATGCGTGATCCCTAGGCA -3´

now let us identify the start and stop codons in 5´⇒3´direction.

  • Start codon ⇒ ATG
  • Stop codon ⇒ TAA, TAG, TGA

5´- GCATA<u>ATG</u>CGTGATCCCTAGGCA -3´ ⇒ 1 start codon at the beginning

5´- GCA<u>TAA</u>TGCG<u>TGA</u>TCCC<u>TAG</u>GCA -3´ ⇒ 3 Stop codons

Second strand: We will do exactly the same procedure

5’-TGCCTAGGAGGGATCACGCATT<u>ATG</u>C-3’⇒ 1 start codon near the end

5’-TGCC<u>TAG</u>GAGGGATCACGCATTATGC-3’⇒ 1 stop codon at the beginning

What we did here was to identify in both provided strands, where the start and stop codons are placed. We can see that in the first strand we have the start codon near the beginning, while in the second strand we have it near the end of the sequence. From this information, we can assume that the first strand is the coding one. <em>However, you need to know that some coding sequences do not have start and stop sequences, because they might correspond to a sequence in the middle of a gene.</em>

So, the sequence of the DNA coding strand with a 5-3 polarity is

5´- GCATAATGCGTGATCCCTAGGCA -3´

8 0
3 years ago
A biologist is studying the possible role of earthworms on the fertility of farm soils. As part of this research, the number of
dimaraw [331]

Answer:

Taking more samples from different parts of an acre.

Explanation:

Validity and accuracy of the data is crucial for any serious research. In this particular case, the most accurate data would be obtained if earthworms would be counted on the whole acre. Of course, this would consume lot of time, people, money etc. That's why methods for estimation are used. Estimation best works with large number of samples. Since one acre equals over 4000 square meters, taking only five samples from such a big area is simply not enough for obtaining valid data.

One of the possible ways to improve estimation is to take more samples per acre while avoiding taking adjacent samples because it could be possible that number of earthworms in one part of an acre is increased (or decreased) for any reason, which would lead us to wrong conclusion.

8 0
3 years ago
Disruption of which organelle, would cause the most change in the function of<br> the cell?
Allisa [31]

Answer:

Is it a true or false question cuz it would be true

8 0
3 years ago
A red blood cell has been placed into three different solutions. One solution is isotonic to the cell, one solution is hypotonic
Dmitry [639]

The type of solution in each beaker based on cell's reaction are :

  • Isotonic solution : Normal reaction
  • Hypotonic solution : The cell becomes turgid
  • Hypertonic solution : The cell becomes deformed

<h3>Matching each solution to the cell reaction </h3>

When the red blood cell is placed in an isotonic solution the solvent flows in and out of the blood cell at the same rate, when the cell is placed in a hypotonic solution the solvent flows into the cell at a faster rate causing the cell to swell ( becomes turgid ) also when the cell is placed in a hypertonic reaction the cell becomes deformed becomes it loses more water than it absorbs.

Hence we can conclude that The type of solution in each beaker based on cell's reaction are : Isotonic solution : Normal reaction, Hypotonic solution : The cell becomes turgid, Hypertonic solution : The cell becomes deformed

Learn more about Types of Solution : brainly.com/question/14350978

#SPJ1

3 0
2 years ago
What are cells that produce new cartilage matrix called?.
Nastasia [14]

Answer:

The stem cells differentiate into chondroblasts. 3. These chondroblasts, located at the periphery of the old cartilage, begin to produce and secrete new cartilage matrix. As a result, they push apart and become chondrocytes, each occupying its own lacuna.

Explanation:

4 0
2 years ago
Other questions:
  • The skin receives approximately ____ of all the blood circulating through the body.​
    7·1 answer
  • What type of receptors embedded in the urinary bladder wall initiate the micturition reflex?
    7·1 answer
  • The goal of sequencing all human DNA base pairs and identifying all human genes belongs to
    15·2 answers
  • Pls answerrrrr guys. i need the answer. if u answer i will mark u as brainliest and follow u too
    15·1 answer
  • Which scientist disprove the idea that life comes from non life?
    7·1 answer
  • What moves lymph through the lymphatic system
    7·1 answer
  • Help on this ap biology question pls
    5·1 answer
  • If potatoes grow by planting actual potatoes not seeds, where did the first potato come from??
    5·1 answer
  • All living things must meet three major challenges of life, what are they​
    7·1 answer
  • Select all that apply.
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!