1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
jasenka [17]
3 years ago
10

What is the difference 8-8?

Mathematics
2 answers:
Lena [83]3 years ago
4 0
The answer would be 0 because 8 taken away from 8 is 0. Hope this helps! ^_^
sergejj [24]3 years ago
3 0
The other day is going well and I'll let you know if you are going out with your grandma tomorrow morning or tomorrow night but I'm still at work house for the surgery next year
You might be interested in
Steven buys 24 bags of flour. Each bag holds 25 pounds of flour. How much flour did Steven buy?
frez [133]
If he has 24 bags and each is 25 pounds, you need to multiply:

24x25=600
Steven bought 600 pounds of flour.
4 0
3 years ago
How much more would the value of y be on the graph than its value
kipiarov [429]

Answer:

180

Step-by-step explanation:

From the table :

Slope :

m = (y2 - y1) / (x2 - x1)

m = (100 - 80) / (5 - 4)

m = 20 / 1

m = 20

y = 20x

Hence, when, x = 12

y = 20 * 12

y = 240

From the graph:

Slope :

m = (y2 - y1) / (x2 - x1)

m = (280 - 70) / (8 - 2)

m = 210 / 6

m = 35

y = 35x

When x = 12

Graph :

y = 35 * 12

y = 420

Difference :

420 - 240

= 180

6 0
3 years ago
Is this a function or not. please add an explanation this is a constructed response
seropon [69]

Answer:

This is an equation for a parabola. All parabolas are functions.

answer: function

Step-by-step explanation:

6 0
3 years ago
Help..................
elena-14-01-66 [18.8K]
Triangle has 180 degrees:
180=2m-3+m+4+3m+5
Combine like terms
180 = 6m+6
Subtract 6 from 180
174=6m
Divide by 6
m=29

Brainliest if that helped, please :)
5 0
2 years ago
Read 2 more answers
Victoria ran 3/4 a mile in 1/3 of an hour. If she continues at this rate, How far will she run in 1 hour
weqwewe [10]

Answer:

2 ¼ miles

Step-by-step explanation:

we can use a ratio

miles:hrs

¾:⅓

x3 x3

9/4:1

2¼:1

3 0
3 years ago
Other questions:
  • The local high school football team, the Falcons, has a contest where seven letters F, A, L, C, O, N, and S are printed in rando
    9·1 answer
  • 2(y + 5) = 18 - 12
    13·1 answer
  • 5/8 + 3/4<br> _________<br> -2/3 - 5/6<br><br><br> What does it equal? Please solve.
    6·1 answer
  • A coastal geologist estimates that a certain country's beaches are eroding at a rate of 1.51, point, 5 feet per year. According
    15·1 answer
  • point) Covert the following integers from decimal notation to binary notation. (Do not put extra zeros in front of your binary n
    7·1 answer
  • What is the simplest form of 145 over 261
    6·2 answers
  • What is the complementary DNA strand for the DNA strand<br> AATTGGCCATGCATGATTACGA
    7·2 answers
  • Dora irons and annual salary of $85,608 how much does she earn every month
    13·2 answers
  • Find the value of x
    5·2 answers
  • If line A has a slope of 7/8, what is the slope of line B that is perpendicular to<br> line A
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!