Explanation:
Translation is the process by which a polypeptide is polymerized from genetic information.
Firstly we have to make a transcription from the coding DNA strand to a single RNA strand (mRNA). RNA pol reads from 5' to 3' of the template strand and nucleotides are added by complementarity ( Adenine with Uracil, Thymine with Adenine and Cytosine with Guanine, Guanine with Cytosine).
DNA: 5'- CGTTATGTGGACTCTCTGGTATGACTCACCTTAT -3'
mRNA: 5'-GCAAUACACCUGAGAGACCAUACUGAGUGGAAUA -3'
mRNA goes to the ribosomes where translation takes place. The enzyme will read every three letters (codon) starting at the start codon sequence (TAC in DNA, AUG in mRNA). According to codons tRNA carrying the amino acids will place it (by complementary to their anticodon) and the enzyme will join it to the nascent polypeptide or protein.
In order to do this we need to look up the genetic code and assign the proper amino acids.
Unfortunately the given strand does not have a start codon TAC codifying for initial methionine.
Answer:
1. CaCO3 + 2HCl → CaCl2 + H2O + CO2
2. C6H12O2 + 8O2 → 6CO2 + 6H2O
Explanation:
Board instances involving eligibility or disciplinary issues that are addressed by a board-approved order public records and accessible on the BON's web page.
<h3>
BON's web page</h3>
Board Position Statements are a way to give nurses guidance on topics that are important to the Board and relate to the safety of the public, but they do not have the legal force of law. In the context of the position statement's overall intent, each position statement is intended to offer direction. Board position statements are examined every year to determine their applicability and accuracy in light of current practice, the Nursing Practice Act, and Board regulations. In January 2022, the Board conducted its most recent evaluation.
It is possible to find a concise summary of the substance of the Position Statements, although it does not include all the specifics that are included in each Position Statement.
Learn more about BON's web page here:
brainly.com/question/16982080
#SPJ1
Answer:
80L
Explanation:
V1/T1 = V2/T2
V2 = V1 T2/T1
T1 = 300K
V1 = 60L
T2 = 400K
V2 = ?
V2 = V1 T2/T1
V2 = (60L)(400K) / (300K)
V2 = 80L
Answer:
A
Explanation:
Recall that Δ<em>H</em> is the sum of the heats of formation of the products minus the heat of formation of the reactants multiplied by their respective coefficients. That is:

Therefore, from the chemical equation, we have that:
![\displaystyle \begin{aligned} (-317\text{ kJ/mol}) = \left[\Delta H^\circ_f \text{ N$_2$H$_4$} + \Delta H^\circ_f \text{ H$_2$O} \right] -\left[3 \Delta H^\circ_f \text{ H$_2$}+\Delta H^\circ_f \text{ N$_2$O}\right] \end{aligned}](https://tex.z-dn.net/?f=%5Cdisplaystyle%20%5Cbegin%7Baligned%7D%20%28-317%5Ctext%7B%20kJ%2Fmol%7D%29%20%3D%20%5Cleft%5B%5CDelta%20H%5E%5Ccirc_f%20%5Ctext%7B%20N%24_2%24H%24_4%24%7D%20%2B%20%20%5CDelta%20H%5E%5Ccirc_f%20%5Ctext%7B%20H%24_2%24O%7D%20%20%5Cright%5D%20%20%20-%5Cleft%5B3%20%5CDelta%20H%5E%5Ccirc_f%20%5Ctext%7B%20H%24_2%24%7D%2B%5CDelta%20H%5E%5Ccirc_f%20%5Ctext%7B%20N%24_2%24O%7D%5Cright%5D%20%5Cend%7Baligned%7D)
Remember that the heat of formation of pure elements (e.g. H₂) are zero. Substitute in known values and solve for hydrazine:
![\displaystyle \begin{aligned} (-317\text{ kJ/mol}) & = \left[ \Delta H^\circ _f \text{ N$_2$H$_4$} + (-285.8\text{ kJ/mol})\right] -\left[ 3(0) + (82.1\text{ kJ/mol})\right] \\ \\ \Delta H^\circ _f \text{ N$_2$H$_4$} & = (-317 + 285.8 + 82.1)\text{ kJ/mol} \\ \\ & = 50.9\text{ kJ/mol} \end{aligned}](https://tex.z-dn.net/?f=%5Cdisplaystyle%20%5Cbegin%7Baligned%7D%20%28-317%5Ctext%7B%20kJ%2Fmol%7D%29%20%26%20%3D%20%5Cleft%5B%20%5CDelta%20H%5E%5Ccirc%20_f%20%5Ctext%7B%20N%24_2%24H%24_4%24%7D%20%2B%20%28-285.8%5Ctext%7B%20kJ%2Fmol%7D%29%5Cright%5D%20-%5Cleft%5B%203%280%29%20%2B%20%2882.1%5Ctext%7B%20kJ%2Fmol%7D%29%5Cright%5D%20%5C%5C%20%5C%5C%20%5CDelta%20H%5E%5Ccirc%20_f%20%5Ctext%7B%20N%24_2%24H%24_4%24%7D%20%26%20%3D%20%28-317%20%2B%20285.8%20%2B%2082.1%29%5Ctext%7B%20kJ%2Fmol%7D%20%5C%5C%20%5C%5C%20%26%20%3D%2050.9%5Ctext%7B%20kJ%2Fmol%7D%20%5Cend%7Baligned%7D)
In conclusion, our answer is A.