1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
harina [27]
3 years ago
13

Which is an element? ... air ...carbon dioxide ...hydrogen ...water Description

Chemistry
2 answers:
d1i1m1o1n [39]3 years ago
7 0
The answer is Hydrogen.

Hydrogen can be found in the periodic table. There other choices are not element but compounds, which is a molecule made of more than ONE element.

Air is a mixture of gas molecules
Carbon dioxide is CO2
Water is H2O

So as you can see, they se al made of different elements
Natalka [10]3 years ago
5 0
All Elements are obtained in the periodic table & water is Not an element it is a compound.
You might be interested in
What is the main purpose of patent attorneys?
Aneli [31]
To protect the patents of those they work . Patents are legal rights of ownership to something that you have made or created.


Please vote my answer branliest! Thanks .
3 0
3 years ago
Read 2 more answers
HELP
Jobisdone [24]

Answer:

hello,

first one is 25.15

second is 301.55

Explanation:

honestly if you look up on the internet there is a converter to get you your answers

5 0
3 years ago
Read 2 more answers
Two identical metal spheres at 8 °C are put into two beakers with equal amounts of water, as shown below.
leva [86]

Answer:

Correct answer is B.

Explanation:

Took the test and got this right. :)

7 0
3 years ago
Read 2 more answers
Is carbonic acid (H2CO3) soluble in water?
NeTakaya

Answer:

it is soluble in water

Explanation:

mark brainliest pliiz cutee:)

8 0
2 years ago
Read 2 more answers
Which chemical reaction needs more energy to break bonds in the reactants
MA_775_DIABLO [31]

Answer:An endothermic reaction

Explanation: In an endothermic reaction, it takes more energy to break the bonds of the reactants than is released when the bonds in the products are formed. In an endothermic reaction, the temperature goes down.

6 0
3 years ago
Read 2 more answers
Other questions:
  • Bobby's mom sets a small pot of water on the stove and lights the burner. Ten minutes later, Bobby notices small bubbles and see
    7·2 answers
  • The density of copper is 8.94 g/cm3. An irregular shaped sample of metal is 14 g and displaces a volume of 2.98 mL. (a) Find the
    9·1 answer
  • What would indicate that a physical change takes place when copper is drawn into wire? Copper is heated, changing its molecular
    10·2 answers
  • On the first day of your new job as a chemist, you are given a bottle of magnesium sulfate and asked to make 30 mL of 0.3 M MgSO
    5·1 answer
  • What is a barometer?
    5·2 answers
  • Which of the following is the balanced equation for the
    6·1 answer
  • A student titrates an unknown amount of potassium hydrogen phthalate (KHC8H4O4, abbreviated as KHP) with 21.30 mL of a 0.1161 M
    7·1 answer
  • Write the pair sequence using the right base for the mouse DNA. ATGGGTGATGTTGAAAAAGGCAAGAAGATTTTTGTTCAGAAGTGTGCCCAGTGCCACACT
    5·1 answer
  • I NEED EXPLANATIONSS!!!! Help , i have to past or my teacher will fail me .. again !!
    8·1 answer
  • 7. Which metal is more easily oxidated, copper or aluminum?
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!