1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Damm [24]
2 years ago
5

The Fluid that surrounds the organelles is....

Biology
2 answers:
sergey [27]2 years ago
6 0
The answer is Cytoplasm
Dmitriy789 [7]2 years ago
4 0

Answer:

cytoplasm

Explanation:

hope it helps,pls mark me as brainliest

You might be interested in
OMG PLEASE HELP QUICK!!!
Anton [14]

Answer:

Maybe ores

Explanation:

8 0
3 years ago
Read 2 more answers
1-5 For the following DNA sequences, replicate the DNA<br> 1. ÇATGGCCTGTAATCCAGCTCGAGTCAAGCC
Natali5045456 [20]

Answer:

The answer i believe is GTAGCT?

Explanation:

I really hope you found this helpful

7 0
2 years ago
Which characteristic makes osmosis different from diffusion?
nalin [4]

A) Net movement in osmosis is from areas of higher water concentration to areas of lower water concentration. Net movement in diffusion occurs from areas of higher solute concentration to areas of lower solute concentration.

This happens so that both solution have roughly the same concentration

3 0
2 years ago
Read 2 more answers
What process recharges this molecules so that it can become ATP again
alexdok [17]
<span>By rebonding with another phosphate molecule through oxidative phosphorylation, it becomes recharged and the ADP to ATP process can be restarted. This allows for more cellular energy to be produced, and more metabolic actions to be undertaken. This is the major aspect of cell respiration.</span>
7 0
2 years ago
How has non-renewable energy and technology improved but at the same time endangered our way of life ? (4 Points) a . Fossil fue
seropon [69]

Answer: I think b

Explanation:

8 0
2 years ago
Other questions:
  • Kelsy contracted an infection caused by a pathogen from the genus Trichophyton. Her doctor gave her a medicated cream to rub on
    11·2 answers
  • Please help, I need in-depth details and explanations?
    9·1 answer
  • In a very small population of birds, assume there are two types of alleles that control feather color. 5 out of 20 total alleles
    6·1 answer
  • Write a short essay that discusses how the structure of amino acids allows this one type of polymer to perform so many functions
    14·1 answer
  • What is blood vessel in humans body?​
    14·2 answers
  • Do you think the offspring produced by the two processes are genetically identical to organism 1? Explain your reasoning.
    8·1 answer
  • What are three characteristics of life that archaea bacteria have?
    7·1 answer
  • A tree of life depicting the hypothetical phylogeny of the three domains is shown above. A star is placed at the common ancestor
    15·1 answer
  • Question 41 A basement membrane anchors Multiple choice question. A) muscle tissue to nervous tissue. B) epithelial tissue to co
    10·1 answer
  • Which organism has a central brain
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!