1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
pogonyaev
3 years ago
5

1.) How can atomic number and mass number be used to find the numbers of protons, electrons, and neutrons?

Chemistry
1 answer:
Contact [7]3 years ago
5 0
I think Atomic mass minus Atomic number is the number of protons
You might be interested in
A nitrogen gas collected in a tube has a volume of 0.86 mL, a temperature of 316.48 degrees kelvin, and a pressure 1.17 atm. Two
rewona [7]
Use the formula PV=NRT to find the amount of moles of nitrogen gas. Then use the same formula using the amount of moles found to find the temperature
6 0
2 years ago
What is the complementary DNA strand for the following sequence:<br> ATGGCTTGCCAAGGTCCGGAAACTTTG
valentina_108 [34]
TACCGAACGGTTCCAGGCCTTTCAAAG
3 0
3 years ago
How many acetate ions are formed when three formula units of zinc acetate dissociate?
jeyben [28]
A formula unit is the same as the empirical formula of a compound or an ionic molecule. It is the lowest ratio of the atoms in the compound or ion. Zinc acetate ions dissociates into zinc ions and acetate ions. The dissociation reaction is expressed as follows:
Zn(O2CCH3)2 = Zn2+ + 2(O2CCH3)1-

We determine the amount of acetate ions produced as follows:

Moles Zn(O2CCH3)2 = (3 formula units Zn(O2CCH3)2) ( 1 mol / 6.022x10^23 formula units) = 4.98x10^-24 mol Zn(O2CCH3)2
moles (O2CCH3)1- = 4.98x10^-24 mol Zn(O2CCH3)2 ( 2 mol (O2CCH3)1- / 1 mol Zn(O2CCH3)2 ) = 9.96x10^-24 mol (O2CCH3)1-
# of acetate ions = 9.96x10^-24 mol (O2CCH3)1- ( 6.022x10^23 ions / 1 mol (O2CCH3)1-) = 6 acetate ions
3 0
3 years ago
A sodium atom has a mass number of 23. Its atomic number is 11. How many electrons does a neutral sodium atom have?
NemiM [27]

Answer:

it contains 11 electrons

Explanation:

4 0
3 years ago
Woodpeckers find insects to eat by pecking holes in trees with their beaks. One day, a woodpecker finds a particular tree that o
bixtya [17]

Answer:

1. Reflex Conditioning

Explanation:

Conditioning is an aspect of learning where a stimulus works effectively in producing a response from an organism. This response becomes regular given the type of reinforcement that is administered to the organism. The reinforcement is usually a reward that is given to the organism.

This is what is observed in the woodpecker.  The stimulus or reinforcement which proves effective in producing a continuous response  from the woodpecker is the abundant supply of the birds favorite bugs. This reinforcement makes it possible for the woodpecker to become conditioned towards returning to the tree.

4 0
3 years ago
Other questions:
  • Which statement describes an advantage of renewable resources they are cheaper than traditional energy sources they are a source
    6·2 answers
  • Describe how fuel oil can be changed into gasoline?
    6·1 answer
  • I need help with this i'm really dumb.<br> Balance<br> p4+o2 ----&gt; p4o10
    11·1 answer
  • You heat a piece of iron from 200 to 400k what happens to the atoms energy of random motion
    7·1 answer
  • Determine the number of molecules present in 4.56 moles of nitrogen (n2).
    8·1 answer
  • The chemical bond between which two atoms is most polar?<br> (1) C–N (3) S–Cl<br> (2) H–H (4) Si–O
    7·2 answers
  • What will happen to the density of a substance if it contracts when it freezes?
    8·1 answer
  • Consider the following reaction.
    14·1 answer
  • Select the correct answer.
    13·1 answer
  • Scientists are now able to use the genetic code of organisms to find out more about their evolutionary history. How is this most
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!