1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Alisiya [41]
3 years ago
10

What is the importance of microvilli to the digestive process?

Biology
1 answer:
Vinil7 [7]3 years ago
7 0
In the small intestine, cells contain microvilli, which are tiny hair-like projections that increase nutrient absorption. These projections increase the surface area of the small intestine allowing more area for nutrients to be absorbed.
You might be interested in
hypothesis that guided some biochemical research in the 1930s was: “Citric acid plays an important role in the breakdown of carb
aev [14]

Answer:

b. How does food yield energy?

Explanation:

The main question is how energy is produced from food such as carbohydrates, fats and proteins etc. First the carbohydrate is converted into glucose molecule and then glucose is absorbed by the cell and is broken down in the mitochondria of the cell with the addition of oxygen and generate energy in the form of adenine tri phosphate. All the scientists wants to know that how a food is converted into energy.

5 0
2 years ago
Which of the following kinds of cells preform basic functions such as obtaining energy from food?
strojnjashka [21]

Plant cells, but not animal cells

Animal cells, but not plant cells

Both plant cells and animal cells

Neither animal cells nor plant cells

Answer:

Both plant cells and animal cells

Explanation:

The process where the energy locked up in food is extracted take place in both plants and animal cells.This process is called Cellular respiration.It is the process of combining inhaled and diffused oxygen in the blood with assimilated food substances (glucose,amino acids,fatty acids and glycerol) to produce energy.

In both cells it takes place in the the cytoplasm and mitochondrial.

It begins with Glycolysis, followed by Krebs's Cycle..These two steps gives certain of ATPs to these cells

.However,the largest amount of ATPs is synthesized during oxidative phosphorylation  for maximum of energy to be produced.This process involved the chemiosmosis where protons were diffused into the intramembranes by the proton pump (PMF) and diffused back into the matrix of the mitochondria to generate the electrochemical gradients.

The electrochemical gradients generate the energy for enzymes ATPase synthase needed for phosphorylation of ADP with Pi to give ATPs.

The oxygen act act the final electron acceptor.

6 0
3 years ago
Which phase comes NEXT?
anyanavicka [17]

Answer:

telophase is the correct answer

Explanation:

sorry if its incorrect.

4 0
2 years ago
Part D
Paladinen [302]

Answer:

About 100 times more than other planets.

Explanation:

The Sun would be about 100 times bigger than the earth planet in the scaled-down model of the solar system because in the reality the size of sun is 109 times more than the earth so making a model more perfect and nearer to reality we have to maintain the diameter of the sun more than 100 times than the earth and other planets.

7 0
2 years ago
Describe the function of Chloropasts
Anna11 [10]

Answer:

Chloroplasts are found in plant cells, they make up the green pigment ( chlorophyll ) which manufactures food for the plant during photosynthesis process.

5 0
2 years ago
Other questions:
  • Which magnitude would be associated with the brightest star?
    12·1 answer
  • Help please! our existing body of scientific knowledge was developed
    8·1 answer
  • How does genetic engineering interfere with natural selection?
    6·1 answer
  • Which steo in not a part if a normal convection cycle?
    11·2 answers
  • While observing some ants, a group of German scientists noticed that the ants had an excellent sense of distance. Wondering how
    15·2 answers
  • After Darwin proposed his ideas about natural selection, scientists began trying to test his ideas in a variety of ways. Which o
    13·1 answer
  • Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequ
    11·1 answer
  • Of all the ways that Renaissance society was hierarchically divided, what was regarded as the most "natural" distinction and the
    9·1 answer
  • Genetic instructions are passed down from parent to offspring through a cellular process called __________ .
    9·1 answer
  • Tại sao chúng ta lại bị trụt rút
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!