1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
shutvik [7]
3 years ago
10

Help me, anyone, if you would please

Biology
1 answer:
mote1985 [20]3 years ago
6 0

Answer:

I would say C

Explanation:

unless the model has mathematical equations in the core, I don't think its A or B. and obviously it isn't interactive unless you want to melt your hand off so i would say C

You might be interested in
Which of the following factors does NOT influence biodiversity?
Oliga [24]
Where is the image of the object
6 0
3 years ago
All animals must be able to take in information and react to their environmental conditions. Describe the organs and organ syste
Artist 52 [7]

Answer:

Nervous system

Explanation:

The nervous system in humans work together to collect information about the external environment because they consist of the brain, spinal cords and neurons. They collect information from external environment and those information travels through neurons from sense organs like eyes, ears, skin e.t.c as a form of electrical impulses. When they get to the end of the neuron, a chemical called neurotransmitters are released which travels across the cells and send it to the brain, the brain then process it and interprete the signals and respond to it as stimulus.

5 0
3 years ago
Can blood cells replicate themselves
svp [43]

Answer:

No

Explanation:

Red blood cells don’t reproduce. They only survive for 120 days in our blood before they are broken down into parts that are then recycled by a special type of white blood cell.

5 0
3 years ago
Read 2 more answers
What function does this structure have
Karo-lina-s [1.5K]
The mouth has the purpose of tasting food to maintain nutrition and to drink water to stay hydrated.

So B: Taste food.

Would be correct.

As the mouth does not help move around, see anything, or hear. Those are the jobs of the other 4 sense.

I hope this helps!
Brainliest is always appreciated if you feel its deserved!
8 0
3 years ago
Please help! #25 and #27and #64!
8_murik_8 [283]
25. D nucleus 
27. A Small molecules are obtained from large molecules during digestion 
64. D (?)
I hope this helps 
5 0
3 years ago
Other questions:
  • Bacteria is the simplest of cells. One special feature of bacterial cells that helps it survive in hostile environments is its
    9·1 answer
  • Canaliculi structure of<br><br>​
    6·1 answer
  • Guard cells are responsible for allowing carbon dioxide to enter a plant. They also control the release of oxygen and water to t
    10·2 answers
  • Vancouver, British Columbia, enjoys a moderate year-round climate due to _____.
    7·1 answer
  • Which statement best describes what the volume of an object represents?
    15·2 answers
  • 4. Which river feature does the arrow point to in the diagram above?​
    15·1 answer
  • AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA
    8·1 answer
  • A solution that is 100 times less acidic than a solution that is pH 2 would<br> have a pH of
    9·1 answer
  • Write a main idea paragraph about cells in general (5 sentences) I'll mark brainliest ! ​
    5·1 answer
  • Electrons in an outer or<br> shell determine the chemical reactivity of atoms.
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!