Answer:
A. S phase
Explanation:
The cell cycle involves all the series of division events that occurs to an organism. Cell division, which can be meiosis or mitosis, involves two main stages viz: Interphase and M phase.
Interphase describes the resting stage of the cell i.e. when the cell is not dividing. The cell uses this time to prepare itself for the next round of division. Interphase stage further consists of three main phases viz: G1, S and G2 phases.
In the S phase or synthesis phase of Interphase, the cell duplicates its genetic material (DNA). Hence, an onion cell observed by a student to have loosely coiled chromatin depicting DNA duplication is in the S-PHASE.
Place is one of the five themes of geography that describes the features that make a site unique such as paris, france has the eiffel tower and the arc de triumph. In addition, the five themes of geography are location, place, region, movement and human environment interaction.
Explanation:
Results in a decline in CD4+T cell numbers below the critical level, and loss of cell-mediated immunity. Therefore the body becomes progressively more susceptible to opportunistic infections and cancer.
Explanation:
The transcription is a process which transcribe the DNA into a molecule which could be read by the machinery to translate it into the proteins and that molecule is known as the mRNA molecule.
1.The mRNA molecule is transcribed by an enzyme called RNA polymerase which transcribe DNA in 5'to 3'direction that is DNA strand will be 3' to 5'direction therefore the strand with 3' to 5' will act as template strand.
2. The RNA polymerase binds at promoter region and there are two sequences in prokaryotes at -35 end which is TTGACA and at -10 end which is TATAAT.
3. The translation begins after the start codon which is AUG therefore proteins will be synthesized after AUG.
In the given question, both promoter sequence are present in the 5'to 3'strand
3’GTAACTGTCGAACTACTGTCTACGTCATATTACGCTAATCGATACTGCCTGCATCGATCGTCGACTGCGGTCCGAA
The mRNA will be -
5'- CAUUGACAGCUUGAUGACAGAUGCAGUAUAAUGCGAUUAGCUAUGACGGACGUAGCUUAGCAGCUGACGCCAGGCUU-3'.
There are two start codon thus two polypeptides will be synthesized.
1. met-thr-asp-ala-val
2. met-thr-asp-val-ala-ser-ser
<span>Warbler Finches are most like the ancestral finch</span>
