1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
alukav5142 [94]
3 years ago
9

Imagine a plant without phloem. for sugars to move from one region of the plant to another, what must happen?

Biology
1 answer:
NeTakaya3 years ago
5 0
I think osmosis can take place in this condition
You might be interested in
Pls answer the picture is attached to this
Ber [7]

Answer:

fish can breath water atoms of negtive atoms with are postive atoms so dose the big bang now we are born you get me  

Explanation:

7 0
3 years ago
This molecule or ion never uses active transport as its motive force for reabsorption into blood capillaries in the kidney.
antiseptic1488 [7]
Water is the substance that does not use the aid of an active transport in the absorption of blood capillarities inside the kidney. An active transport would only be applicable if the molecule requires being transferred from an area lower concentration to the area of higher concentration across a membrane. 
7 0
3 years ago
Which feature is shared by protists, fungi, plants, and animals but is lacking in bacteria?
ANTONII [103]
B, a nucleus. Nuclei are membrane-bound organelles inside eukaryotic organisms. Eukaryotes are protists, fungi, plants, and animal cells. A bacteria is not a eukaryote, it is a prokaryote, so it does not have the membrane-bound structure of the nucleus.

Be careful, though, bacteria still have DNA. It is simply located in the center of the cell and is not encased in a membrane.
7 0
4 years ago
Read 2 more answers
3. Is it possible that all elements of an Eco-system stay in balance with each
Pie

Answer:

yes

Explanation:

the food chain is a HUGE part of the eco-system  because it is based off of plant animals and even the sun which is what makes up most of our earth

3 0
3 years ago
What will most likely happen if a person does not consume the minimum daily requirement of carbohydrates?​
Natasha_Volkova [10]

Answer:

the body will break down chitin from the bones and glycogen from the liver hope it helps pls mark brainliest

3 0
3 years ago
Other questions:
  • Chemical processes store and release _____ in the bonds of molecules.
    6·2 answers
  • What are the bubbles composed of when pennies are in vinegar
    14·2 answers
  • Most species of cyanobacteria are enclosed in a _____.
    12·1 answer
  • How can you tell that the green sum on a pond is a plant
    15·1 answer
  • Need help on this !!
    14·1 answer
  • What is the other name of root cap?
    7·2 answers
  • 6. A characteristic common to both diffusion and active transport is that
    8·1 answer
  • Sawgrass takes in light energy during photosynthesis. What happens to most of this energy?
    11·1 answer
  • Write the code for RNA from this DNA STRAND :<br><br> AAAAAATTTTTTCCCGGGGTTTATATATC
    15·1 answer
  • What properties are needed for something to be considered living? <br> (4 answers needed)
    11·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!