Explanation:
Translation is the process by which a polypeptide is polymerized from genetic information.
Firstly we have to make a transcription from the coding DNA strand to a single RNA strand (mRNA). RNA pol reads from 5' to 3' of the template strand and nucleotides are added by complementarity ( Adenine with Uracil, Thymine with Adenine and Cytosine with Guanine, Guanine with Cytosine).
DNA: 5'- CGTTATGTGGACTCTCTGGTATGACTCACCTTAT -3'
mRNA: 5'-GCAAUACACCUGAGAGACCAUACUGAGUGGAAUA -3'
mRNA goes to the ribosomes where translation takes place. The enzyme will read every three letters (codon) starting at the start codon sequence (TAC in DNA, AUG in mRNA). According to codons tRNA carrying the amino acids will place it (by complementary to their anticodon) and the enzyme will join it to the nascent polypeptide or protein.
In order to do this we need to look up the genetic code and assign the proper amino acids.
Unfortunately the given strand does not have a start codon TAC codifying for initial methionine.
The volume of a 1.86-carat diamond in cubic centimeters is 0.106 cm³
Given,
The density of a diamond is 3.513 g/cm³.
We have to find out the volume of a 1.86-carat diamond in cubic centimeters.
Convert the units of the diamond from carat to grams, we have:
(1.86 carats) x (0.200 g / 1 carat) = 0.372 g
The volume of the diamond is obtained by dividing the mass by the density, therefore using the formula, we get
v = m / d
v = 0.372 g / (3.51 g/cm³) = 0.1059 cm³
or, v = 0.106 cm³ (approx)
Therefore, the volume of a 1.86-carat diamond is approximately 0.106 cm³.
To learn more about the volume, visit: brainly.com/question/1578538
#SPJ9
117 L. You can start by making a table to organize the information you are given. Then, you can use the formula PV/T=PV/T and plug in the numbers you have. You then solve for the missing volume. Remember that the initial pressure, temperature, and volume should be on one side of the equal sign, and the final pressure, volume, and temperature should be on the other side.
Your answer is D rods and cones. Hope this helps!! :)
