1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
olya-2409 [2.1K]
3 years ago
11

What do i do to comfort my sister who is going through her first period.

Biology
2 answers:
grigory [225]3 years ago
4 0
You can tell her all about how it is healthy for her and how every girl has it, and it's nothing to be ashamed of. It will come for about 3-4 days and it will go away. Just tell her that.. if it didn't help then srry.
TEA [102]3 years ago
3 0
If she has cramps Dark chocolate helps with that.But just give her advise on some things.Tell her it gets better and its just part of life.
You might be interested in
When acetyl-CoA is fed into the TCA cycle, it eventually forms carbon dioxide. The energy released from this oxidation is conser
Kay [80]

Answer:

The correct answer is:

a)FADH2

c)GTP

e)NADH

Explanation:

The Citric acid cycle(TCA) also known as the <em>Kreb cycle,</em> is a focal metabolic center of the cell. It is a sequence of chemical reactions in which the acetyl portion of acetyl CoA is degraded to carbon dioxide and hydrogen atoms.These reactions all occur in the matrix of the mitochondria. This cycle is also an important source of precursor for other molecules such as amino acids, nucleotide bases cholesterol etc. The function of the citric acid cycle is the gathering of high-vitality electrons from carbon fuels. The citric acid cycle removes electrons from acetyl CoA and use it to reduce NAD and FAD into NADH2 and FADH2 respectively.

<em>Overall, The citric acid cycle oxidizes two carbon units(from acetyl CoA) and produces two molecules of carbon dioxide, one molecule of GTP and high energy electrons which are present in the form of NADH2 and FADH2</em>

4 0
2 years ago
The ability to combine visual images from both eyes
ratelena [41]

Answer:

<u>VISION </u> is the ability to combine visual images from both eyes.

4 0
3 years ago
A chromosome that is exposed to a mutagen breaks into two pieces. A portion off one of the ends is removed before the two pieces
larisa [96]
The type of chromosomal mutation that occurs here is an example of a deletion mutation. Specific genetic data, or DNA is removed and the remaining portions of chromosomal information have rejoined.
3 0
3 years ago
Read 2 more answers
Which part of the brain is responsible for coordinating muscle movements and maintaining balance?
mr Goodwill [35]
The Cerebellum is responsible for coordinating muscle movements and maintaining balance
7 0
3 years ago
01) How is aerobic respiration similar to combustion?
frozen [14]
Both use oxygen, both produce energy, both give out carbon dioxide as the result and the overall chemical reactions are the same.
Hope this helps :)
7 0
3 years ago
Read 2 more answers
Other questions:
  • Compare and contrast the three major principles of geologic change. How are they all similar and how are they all different?
    10·1 answer
  • Small, hair-like parts called
    6·1 answer
  • A drug that is created by slightly modifying the molecular structure of another substance is a(n) __________ drug.
    11·1 answer
  • Which of the following tastes may be detected at very low concentration?
    11·2 answers
  • What is the predominant type of tissue found in the Thymus in a young child? Please help!
    8·1 answer
  • Why are data tables useful in an experiment?
    12·2 answers
  • The organ that carries sperm from the epididymis to the urethra is the
    9·1 answer
  • Explain why cells are small instead of large
    9·1 answer
  • What does it mean for a cell membrane to be selectively permeable?
    13·1 answer
  • AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!