1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
kramer
3 years ago
12

Is the formation of a new species from an existing species and can occur in two phases.

Biology
2 answers:
sattari [20]3 years ago
8 0

Answer:

Speciation

Explanation:

edu2020

s344n2d4d5 [400]3 years ago
7 0

Answer:

Meiosis

Explanation:

Meiosis is the formation of a new species from an existing species and can occur in two phases.

Hope it helps.

You might be interested in
PLS HELP MEEEE!!!!!!!
Kobotan [32]
The last one is right
6 0
3 years ago
Read 2 more answers
small grasses are usually the first plants to appear in an area after a disturbance. these grasses are an example of which type
zaharov [31]
Answer: C. Pioneer species
8 0
3 years ago
Read 2 more answers
Three cells undergo meiosis. How many haploid cells are produced
tresset_1 [31]

When meiotic cell division occurs, a diploid parent cell experiences cell division to produce four haploid cells. Thus, if three parent cells undertake meiosis, <u>twelve haploid cells</u> will be created.

7 0
3 years ago
Read 2 more answers
Which by product is released by plants after the light reaction step in photosynthesis occurs?
frez [133]

Answer:

Photosynthesis releases oxygen once the whole procedure is done and produces most common glucose carbohydrate molecules.

Explanation:

3 0
2 years ago
Which of the following occurs in the matrix of a mitochondrion? ETC glycolysis Krebs cycle carbon fixation
Nata [24]
The answer should be the Krebs Cycle. Hope this helped!
6 0
3 years ago
Read 2 more answers
Other questions:
  • Robert believes that rotten meat gives rise to flies. To what theory of evolution does he adhere to?
    13·1 answer
  • A single strand of DNA is ATTCGGCTATTTACGATTGCCAT what is the other strand?
    8·1 answer
  • What happens when sodium potassium pump stops working?
    14·1 answer
  • A test tube fell on the floor and broke! What would you do? Check all that apply.
    6·2 answers
  • What process produces the sediments that ultimately lead to soil formation? rainfall leaching topography weathering
    10·2 answers
  • 10 points!!! :)
    15·1 answer
  • Do antimicrobials affect bacteria or do bacteria affect antimicrobials?
    15·1 answer
  • What is a silent mutation?
    9·1 answer
  • 5. Waves that can travel with or witout a medium are called mechanical *
    11·1 answer
  • True or false: the tubuloglomerular feedback mechanism acts as a 'backup' mechanism to the myogenic mechanism in response to inc
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!