1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
kifflom [539]
3 years ago
6

What is the term that means the knowledge that quantity is unrelated to the arrangement and physical appearance of objects?

Biology
1 answer:
8090 [49]3 years ago
4 0

The term that refers to the knowledge that the quantity of a substance is entirely unrelated to their arrangement and physical appearance is known as conservation. This includes the number, mass, length, weight, area, and volume of the objects. Based on this knowledge, one can say that the substance's appearances can be deceiving when it comes to its quantity.

Hence, the answer is 'conservation'.

You might be interested in
what is the sequence of mRNA codons that are synthesized during transcription that go with TACCGGATGCCAGATCAAATC, TACGGGGGCGTAAC
VLD [36.1K]

Answer:

Tfftfxggfddsd

Explanation:

Because of the condons

7 0
3 years ago
A human ingests a tapeworm. The tapeworm lives in the human's intestines and absorbs nutrients, preventing the human from receiv
agasfer [191]

Answer:

Parasite

Explanation:

The tape worm is a parasite because while it benefits its host is harmed.

6 0
3 years ago
Read 2 more answers
What empirical evidence could most effectively and directly be used to convince law makers to remove a dam that is blocking a ri
9966 [12]
<span>B.) Information on the distance from the ocean to the rivers that the salmon use. >? i think this would be it since they would not even be able to reach the area needed to breed >?</span>
8 0
3 years ago
Read 2 more answers
if an element has a half-life of 30 million years and there is 12.5% of it remaining in a rock, how old is that rock
Assoli18 [71]

Answer:

The half-life of a substance is the amount of time it takes for half of that substance to decay. However, after two half-lives, half of the half remaining will decay, leaving you with one quarter of the original substance.

So, after 1 million years you will have 50% of the original substance remaining.

And, after 2 million years you will have 25% of the original substance remaining.

After 3 million years you will have 12.5% of the original substance remaining.

And after 4 million years you will have 6.25% of the original substance remaining.

Explanation:

Hope it helps:)

3 0
3 years ago
Please helppp me with this
ArbitrLikvidat [17]

Answer: Blue because of google lol

8 0
3 years ago
Other questions:
  • If a therapist gives an alcoholic a drink laced with a nausea-inducing drug so that she or he will become ill after drinking the
    6·1 answer
  • Why is the pairing of nitrogen bases key to understanding how DNA replication occurs?
    12·1 answer
  • There are two different alleles for flower color, P and p. The image shows a white sweet pea that is labeled with its two allele
    7·2 answers
  • Which of the following is not an accurate description of chemical reactions?
    13·2 answers
  • What are convection currents
    10·2 answers
  • Why are enzymes needed during DNA replication?
    11·1 answer
  • Plants lose water from their above ground surfaces in the process of transpiration. Most of this water is lost from stomata, mic
    10·1 answer
  • Explain the influence of the Sun and the Moon on Earth's tides. (6)
    14·1 answer
  • Blocks of genetic material that do not recombine and are passed on for generations are called.
    13·1 answer
  • When DNA condenses in preparation for cell division, it is called a __________.
    9·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!