1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Maksim231197 [3]
2 years ago
14

What is the Na+ concentration in each of the following solutions:

Chemistry
1 answer:
iren [92.7K]2 years ago
5 0

Sodium Sulfate = Na2(SO4) meaning there are two ions of Na+ in one mole of Sodium Sulfate the M stands for Molarity, defined as Molarity = (moles of solute)/(Liters of solution), So if the Na2SO4 solution is 3.65M that means one Liter of has 3.65 moles of Na2SO4, the stoichiometry of Na2SO4 shows that there would be two Na+ ions in solution for every one Na2SO4.

Therefore if 3.65 moles of Na2SO4 was to dissolve, it would produce 7.3 moles of Na+, and since this is still a theoretical solution, we can assume 1 L of solution.

Finally we find [Na+] = 2*3.65 = 7.3M

Use the same logic for parts b and c




You might be interested in
How many neutrons does element X have if its atomic number is 35 and its mass number is 76?
Nastasia [14]

Formula for calculation of neutrons is Mass number - atomic number, here values are given. By putting values in formula 76-35= 41. Number of neutrons 41

6 0
3 years ago
What is the empirical mass of SO2?<br> Answer using four significant figures.
timofeeve [1]
The atomic mass is 64.07
3 0
3 years ago
Read 2 more answers
An element is?
Sidana [21]

i think it’s D , not sure though

4 0
2 years ago
Read 2 more answers
DNA instructions: GCCUAAUGCCCGAGUAACACC GGU TRANSCRIBE THE ABOVE DNA PATTERN into mRNA message​
Katarina [22]

CGGAUUACGGGCUCAUUGUGGCCA

7 0
3 years ago
Help me now When you look up into the night sky, you will usually see the moon. If you were to look at it each
Mama L [17]

Answer:

Your pee

Explanation:

When you have to pee you pee

6 0
3 years ago
Other questions:
  • In which solid sound travel faster than any others.ans me pls​
    14·2 answers
  • Many organisms in an ecosystem copete with each other for resources. What might different species of trees in a forest ecosystem
    14·2 answers
  • A beaker with 1.60×102 mL of an acetic acid buffer with a pH of 5.000 is sitting on a benchtop. The total molarity of acid and c
    9·1 answer
  • Please help anwser this question will rate and if 2 people anwser it will give out brainly
    10·2 answers
  • An element's atomic mass does not include the mass of its _____.
    7·1 answer
  • True of false? Scientists estimate that one thimble of soil could hold more than 20,000 microorganisms.
    5·2 answers
  • Convert 3 mol of Co, to grams.
    14·1 answer
  • Please help me with this chem question. Only answer if you know it.
    6·2 answers
  • What does the mass number of an atom represent?.
    11·1 answer
  • Calcium propionate [Ca(CH₃CH₂COO)₂; calcium propanoate] is a mold inhibitor used in food, tobacco, and pharmaceuticals.(a) Use b
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!