1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Vilka [71]
4 years ago
12

Please help me! This is too hard!?

Chemistry
1 answer:
Annette [7]4 years ago
5 0

Answer: 59.24 atm

Explanation:

Given that:

Original Volume of gas V1 = 2.7L

Temperature T1 = 42.7°C

Convert Celsius to Kelvin

(42.7°C + 273 = 315.7K)

Pressure P1 = 684.9 torr

Final Volume V2 = 0.14 L

Final temperature T2 = 803.1°C

Convert Celsius to Kelvin

(803.1°C + 273 = 1076.1K)

Final pressure = ?

Then, apply the combined gas equation

(P1V1)/T1 = (P2V2)/T2

(684.9 torr x 2.7L)/315.7K = (P2 x 0.14L)/1076.1K

1849.23/315.7 = 0.14P2/1076.1

Then, cross multiply

1849.23 x 1076.1 = 315.7 x 0.14P2

1989956.403 = 44.198P2

Divide both sides by 44.198

1989956.403/44.198 = 44.198P2/44.198

45023.67 torr = P2

Now, convert the pressure in torr to atmosphere

If 760 torr = 1 atm

45023.67 torr = Z atm

Then, cross multiply

760 torr x Z = 45023.67 torr x 1 atm

Z = 45023.67 torr / 760 torr

Z = 59.24 atm

Thus, the new pressure of the gas will be 59.24 atm

You might be interested in
What is minimum volume of oxygen required to react with 42.5 g of aluminum in the synthesis of aluminum oxide at stp?
natka813 [3]
<span>26.833 liters

Aluminum oxide has a formula of Al</span>₂O₃,<span> which means for every mole of aluminum used, 1.5 moles of oxygen is required (3/2 = 1.5).

Given 42.5 g of aluminum divided by its atomic mass (26.9815385) gives 1.575 moles of aluminum.

Since it takes 1.5 moles of oxygen per mole of aluminum to make aluminum oxide, you'll need 2.363 moles of oxygen atoms.

Each molecule of oxygen gas has 2 oxygen atoms, so the moles of oxygen gas will be 2.363/2 = 1.1815

Finally, you need to calculate the volume of </span>1.1815 <span>moles of oxygen gas.
1 mole of gas at STP occupies 22.7 liters of volume. Therefore,

1.1815 * 22.7 = </span>26.8 liters <span>of oxygen gas.
</span>
6 0
3 years ago
Calculate the atomic mass of Carbon if the two common isotopes of carbon have masses of
Mars2501 [29]

Answer:

Average atomic mass of carbon = 12.01 amu.

Explanation:

Given data:

Abundance of C¹² = 98.89%

Abundance of C¹³ = 1.11%

Atomic mass of C¹² = 12.000 amu

Atomic mass of C¹³ = 13.003 amu

Average atomic mass = ?

Solution:

Average atomic mass of carbon = (abundance of 1st isotope × its atomic mass) +(abundance of 2nd isotope × its atomic mass)  / 100

Average atomic mass of carbon = (12.000×98.89)+(13.003×1.11) /100

Average atomic mass of carbon=  1186.68 + 14.43333 / 100

Average atomic mass of carbon = 1201.11333 / 100

Average atomic mass of carbon = 12.01 amu.

5 0
3 years ago
AC current is produced by which of the following things?
pogonyaev

Answer:

B

Explanation:

5 0
2 years ago
Read 2 more answers
Sunlight strikes Earth’s surface at different angles This angle is called the angle of
stira [4]

Answer:

Earth takes in thermal energy from the Sun in a process called. ... Sunlight strikes Earth's surface at different angles. This angle is called the angle of. ⇒ insolation.

Explanation:

Report the guy that spammed, he spams for points and doesn't even try to help.

4 0
3 years ago
The burning of magnesium is a highly exothermic reaction. How many kilojoules of heat are released when 0. 75 mol of Mg burn in
alexandr402 [8]

Taking into account the definition of enthalpy of a chemical reaction, the quantity of heat released when 0.75 moles of Mg are burned is 451.5 kJ.

<h3>Enthalpy of a chemical reaction</h3>

The enthalpy of a chemical reaction is known as the heat absorbed or released in a chemical reaction when it occurs at constant pressure. That is, the heat of reaction is the energy that is released or absorbed when chemicals are transformed into a chemical reaction.

The enthalpy is an extensive property, that is, it depends on the amount of matter present.

<h3>Heat released in this case</h3>

In this case, the balanced reaction is:

2 Mg(s) + O₂ (g) → 2 MgO(s) + 1204 kJ

This equation indicates that when 2 moles of Mg reacts with 1 mole of O₂, 1204 kJ of heat is released.

When 0.75 moles of Mg are burned, then you can apply the following rule of three: if 2 moles of Mg releases 1204 kJ of heat, 0.75 moles of Mg releases how much heat?

heat=\frac{0.75 moles of Mgx1204 kJ}{2 moles of Mg}

<u><em>heat= 451.5 kJ</em></u>

Finally, the quantity of heat released when 0.75 moles of Mg are burned is 451.5 kJ.

Learn more about enthalpy of a chemical reaction:

<u>brainly.com/question/15355361</u>

<u>brainly.com/question/16982510</u>

<u>brainly.com/question/13813185</u>

<u>brainly.com/question/19521752</u>

4 0
2 years ago
Other questions:
  • Explain how heat is related to thermal energy
    10·2 answers
  • Consider the balanced chemical equation,
    14·2 answers
  • _____ energy is energy available to do work.
    15·2 answers
  • Describe how water is a destructive force to land features on the surface of the Earth and provide at least three examples. Desc
    8·1 answer
  • Diborane (B2H6) is a gas at room temperature that forms explosive mixtures with air. It reacts with oxygen according to the foll
    6·1 answer
  • Which of the following statements would be the hypothesis most easily tested? a) Oak trees grow tallest between temperatures of
    11·1 answer
  • Which of the following is NOT an
    7·2 answers
  • Predict how the surface of a sand dune would change if a river began flowing through the area over the course of 10,000 years. W
    10·1 answer
  • Write the pair sequence using the right base for the mouse DNA. ATGGGTGATGTTGAAAAAGGCAAGAAGATTTTTGTTCAGAAGTGTGCCCAGTGCCACACT
    5·1 answer
  • How does Dr. Hayes' and Dr. Malaska’s research differ? Why are both research projects important?
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!