1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Firlakuza [10]
3 years ago
11

The monomers of carbohydrates are called

Biology
1 answer:
yan [13]3 years ago
8 0

monosaccharides. Such as glucose or fructose

You might be interested in
5' ATGCCCGGGTGTCGTAGTTGA3' Complete the complementary sequence for the template strand
drek231 [11]

the complementary strand would be 5' TACGGGCCCACAGCATCAACT3'

the complementary strand would be this sinceyoujust switch the letter in the strand out for its pair when looking for a comlementry strand

so for reference heres a little cheat guide

Adenine=Thymine

Thymine=Adenine

Guanine=Cytosine

Cytosine=Guanine



5 0
2 years ago
Describe how physical and chemical structure of red blood cells is related to its function
Leokris [45]
The chemical structure shows what the red blood cell does.and the physical appearance also shows the same.
8 0
3 years ago
Properties of life include the use of blank to power an organisms activities
OlgaM077 [116]

Answer:

Properties of life include the use of <u><em>energy</em></u> to power an organisms activities.

Explanation:

Energy is the driving force which allows every cell to perform its functions. Organisms like humans tend to gain energy by the process of cellular respiration. Cellular respiration can be described as a process in which organisms make carbon dioxide and water from glucose (from food) and oxygen (from air). Huge amounts of ATP is also released during this process. In plants, the process of photosynthesis and cellular respiration supplies them with the energy sources.

6 0
3 years ago
In an oil spill, why does the oil not mix with the sea water? Lipids are hydrophobic. Lipids are hydrophilic. Lipids are saturat
Bezzdna [24]
Lipids are hydrophobic is the answer you are looking for.
6 0
3 years ago
Read 2 more answers
The preserved remains of trilobites suggest that these organisms lived in the seas for about 380 million years. They also indica
melomori [17]
I think answer should be b.
5 0
3 years ago
Read 2 more answers
Other questions:
  • Which term describes the chromosomal abnormality of having extra chromosomes?
    11·2 answers
  • Which best describes the order of the technology used to transmit a sound through the radio? microphone → transmitter → micropho
    12·2 answers
  • Identify the type of energy involved in each step
    9·1 answer
  • PLEASE HELP! ASAP!
    7·1 answer
  • Which movement decreases the angle between articulating bones?
    11·1 answer
  • Skin color in humans, a polygenic trait, is coded for by a combination of 378 genes. How many alleles would
    11·1 answer
  • Please help me and no file this is due today and
    5·1 answer
  • In what part of the world would we see the most extreme drop in temperatures (during colder) due to changes in currents of the w
    10·1 answer
  • The two pathways fundamentally involved in the physiological response to stress are
    8·1 answer
  • Based on the characteristics described, which category do you think humans belong to? Why do you think they fit in this category
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!