1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Nataly [62]
3 years ago
11

What happens to temperature and pressure as the depth within the Earth increases?

Biology
2 answers:
Oduvanchick [21]3 years ago
8 0

Answer:

Temperature and pressure progressively increase with increased proximity to Earth's core. Recent studies indicate the core's temperature may be close to 11,000 degrees Fahrenheit; that's nearly 2,000 degrees warmer than previously thought and hotter than the surface of the Sun, according to a 2013 Forbes article.

Explanation:

Tanzania [10]3 years ago
7 0

Answer:

Diffusion is the movement of particles from a high to low particle concentration, while osmosis is the movement of water from a high to a low water concentration.

Explanation:

You might be interested in
Please Help Mark and Vikki live in two different areas of North America. The temperature in Mark’s town today is 30°F. The tempe
uysha [10]

Answer:

I assume there could be a change in water vapour in the weather as the coldness and the clouds in the city of Mark will transform into ice and fall like snow. And it is really warm in the town of Vikki, and the vapour of water may fall as rain.

Explanation:

I assume there could be a change in water vapour in the weather as the coldness and the clouds in the city of Mark will transform into ice and fall like snow. And it is really warm in the town of Vikki, and the vapour of water may fall as rain.

See above

Please mark brainliest

<em><u>Hope this helps.</u></em>

6 0
3 years ago
Infection is the invasion of colonization of the body by potentially pathogenic microorganisms true or false
k0ka [10]
TRUE.
Infection is the invasion or colonization of the body by potentially pathogenic microorganisms.
4 0
3 years ago
Protein c is associated with the membrane and is known to be responsible for signal transduction. it is coded for by a gene name
zysi [14]
<span>In liver, the most intensively studied transmembrane and intracellular signal transduction pathways are the Janus kinase signal transduction pathway, the mitogen-activated protein kinases signal transduction pathway, the transforming growth factor β signal transduction pathway, the tumor necrosis factor α signal transduction pathway and the recently discovered sphingolipid signal transduction pathway. All of them are activated by many different cytokines and growth factors. They regulate specific cell mechanisms such as hepatocytes proliferation, growth, differentiation, adhesion, apoptosis, and synthesis and degradation of the extracellular matrix. The replication cycle of hepatitis C virus (HCV) is intracellular and requires signal </span>
4 0
3 years ago
Mrs. Jones who has dementia. She continues to ask for her husband, whom you know passed away several years ago. How would you as
wlad13 [49]

Answer:

You tell her that her husband is away and will be coming back later

Explanation:

If you tell her he's dead, she won't believe you so just go along with it.

3 0
2 years ago
2. Transcribe the following DNA segment 5’ agcgggatgagcgcatgtggcgcataactg3’ 3’ tcgccctactcgcgtacaccgcgtattgac5’ 3. Translate the
Ierofanga [76]
<span>3’ tcgccctactcgcgtacaccgcgtattgac 5’ </span>turns into:
5' agcgggaugagcgcauguggcgauaacug 3'

adenine becomes uracil hope this helped :)
6 0
3 years ago
Other questions:
  • The net primary productivity for a temperate forest was measured as 2,000 mg c/m2/day. the respiratory rate of the community was
    12·1 answer
  • gravity on the moon's surface is 1/6 the gravity on earth's surface. what would a person who weighs 690 N on earth weigh on the
    7·1 answer
  • Which characteristic of life relies on the sun
    9·2 answers
  • What causes sweating during running in order to maintain homeostasis? Jenny is running for more than an hour on a pleasant sunny
    12·2 answers
  • Why is the gravitational potential energy of an object 1 meter above the moon’s surface less than its potential energy 1 meter a
    6·1 answer
  • A food change is an ecosystem flows from green algae, to freshwater snails, to small fish, and finally to large fish. Which orga
    13·1 answer
  • Airplanes reach cruising altitudes at the lower part of the Earth's stratosphere. This portion of the atmosphere is made up most
    6·1 answer
  • Is the formula balanced as written? Why or why not?
    7·1 answer
  • Organisms classified into the Protist Kingdom have<br> what type of cells
    7·2 answers
  • Help please thank you
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!