1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Butoxors [25]
4 years ago
13

Forward primer: 5'-AGTCTACTCGTAACCGGTTACC-3' Reverse primer: 5'-TAAGGCATCATGGTAACCGGTT-3' The two primers above have the melting

temperatures between 55C-80C. What is the reason that these two primers will not bind effectively to the region of DNA that we want to amplify?
Biology
1 answer:
CaHeK987 [17]4 years ago
5 0

Answer:

Short answer is primers are partially complementary.

Explanation:

Forward primer: 5'-AGTCTACTCGTAACCGGTTACC-3'

Reverse primer: 5'-TAAGGCATCATGGTAACCGGTT-3'

When we write reverse primer 5' to 3' we can easily see that

3'-TTGGCCAATGG---5' is complementary to the forward primers'

5'---AACCGGTTACC-3' sequence. So instead of binding to the template DNA these primers might bind each other resulting with reduction of efficiency of DNA amplification.

You might be interested in
In 3 sentences explain how photosynthesis and cellular respiration are interrelated.
fenix001 [56]

Answer: Photosynthesis produces glucose cellular respiration uses glucose produced by photosynthesis.

Photosynthesis produces oxygen while cellular respiration uses oxygen produced by photosynthesis.

Photosynthesis uses carbon dioxide released in cellular respiration while cellular respiration produces carbon dioxide

Explanation: The products of photosynthesis are the reactants in cellular respiration while the products of cellular respiration are the reactants of photosynthesis. One reaction depends on the other to furnish it with the reactants. Photosynthesis depends on cellular respiration for the supply of carbon dioxide and water while cellular respiration depends on photosynthesis for the supply of oxygen and glucose. The balanced chemical equation for photosynthesis is 6CO2 + 6H2O+ sunlight --> C6H12O6 + 6O2

The balanced chemical for cellular respiration is C6H12O6 + 6O2 --> 6CO2 + 6H2O + Energy

6 0
3 years ago
There are six kingdoms. what is the sixth kingdom?
koban [17]

Answer:

genus is the correct answer k.p.c.o.f.g.s

8 0
3 years ago
Which of the following are thought to be most closely related to humans?
Oxana [17]

The correct answer is: sea stars

All animals listed above are invertebrates. One of the characteristic of invertebrates are that they are protostomes with the exception of Echinodermata (sea stars). The difference between protostomes and deuterostomes is in their embryonic development (orgin of mouth and anus).

In protostomes the mouth forms first: the oral end of the animal develops from the first developmental opening. On the other hand in deuterostomes the first opening (the blastopore) becomes the anus, and the oral end of the develops from the second opening.

Humans are also deuterostomes.  

4 0
3 years ago
A woman with type a blood (genotype: ao) is married to a type b person (genotype: bo). What blood types will their children have
BARSIC [14]

The blood types of the children formed from a woman with type A blood (genotype: AO) is married to a type B person (genotype: BO) is:

  • AB
  • AO
  • BO
  • OO

<h3>How to cross parents with specific genotype?</h3>

According to this question, a woman with genotype AO is crossed with a man of genotype BO.

This means the following cross will be performed:

AO × BO

The offsprings of this cross will have the following genotype:

  • AB
  • AO
  • BO
  • OO

Learn more about genotype at: brainly.com/question/12116830

8 0
2 years ago
If one nerve stimulus arrives at a muscle fiber so soon that the fiber does NOT relax at all from the previous twitch, the most
BaLLatris [955]

Answer:

Complete Tetanus

Explanation:

The nerve stimulus arrives at the fiber at such a rapid pace that there is no decrease in tension between stimuli detected. This results in a tectanic contraction that is fused (complete) . Thus the muscle fiber does not relax at all due to this complete tetanus.

6 0
3 years ago
Other questions:
  • If a chromosome has 4 chromosomes in each sperm cell, its diploid number is
    7·1 answer
  • The area(s) of the world where child labor is most prominent is/are
    8·1 answer
  • Incomplete Dominance—Predicting Flower Color in Snapdragons
    9·2 answers
  • which result would be most likely to occur during mrna processing, exons were removed and introns are spliced together
    12·1 answer
  • Which is the first step to occur during the process of replication?
    15·1 answer
  • This problem has been solved!See the answerIn sheep, coat color is influenced by two genes. Gene A influences pigment production
    5·1 answer
  • Think about how all the northern right whales currently alive are the product of only three different females. Why does it matte
    6·1 answer
  • Need mRNA <br> AMINO ACIDS <br> 1.AATACGGGGGCGTAACCACTA<br> 2. GCTAGTACGTGCACATTAGAA
    5·1 answer
  • Which type of energy refers to the sum of potential and kinetic energies in the particles of a substance?
    12·1 answer
  • Answer all 3 parts of this essay question:
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!