Low power 50x (5x10)
high power 250x (5x50)
If you want to calculate the microscope power of magnification you have to multiple the magnification power of the ocular with the magnification power of the objectiv.
Answer:
Data is used to evaluate the treatment that is provided to the patient in each episode of nursing diagnosis.
Explanation:
An outcome measure is a tool that is used to assess the current status of the patient that is influenced by the nursing interventions. It is marked by the status of the resolution for individual nursing diagnosis as being either resolved or not.
The data collected by outcome measures supports in establishing the foundation for providing the correct medical treatment to the patient. Which later helps to assess the treatment provided to the patient. It provides reliable and credible justification for the treatment on an individual patient level.
Below are a few examples of these outcome measures;
- Mortality
- Timeliness of care
- Safety of care
- Patient Experience
- Effectiveness of care
Full question attached
Answer/ Explanation:
The original DNA sequence has a point mutation changing a G to a T. The resulting mRNA produced is always complementary to the DNA from which it is synthesised, so the original mRNA sequence has a T, whereas the mutated mRNA has a U. The tRNA is complementary to the mRNA, so the original has a G, and the mutated has a T.
<h3>Original DNA</h3>
GTTGGCGAATGAACGGAGGCTGACGTCTAAGCCTAGAAAAATTGG
RNA
CAACCGCUUACUUGCCUCCGACUGCAGAUUCGGAUCUUUUUAACC
tRNA
GUUGGCGAAUGAACGGAGGCUGACGUCUAAGCCUAGAAAAAUUGG
<h3>_______________________________________________</h3><h3>Mutated DNA</h3>
GTTGGCGAATGAACTGAGGCTGACGTCTAAGCCTAGAAAAATTGG
RNA
CAACCGCUUACUUGUCUCCGACUGCAGAUUCGGAUCUUUUUAACC
tRNA
GUUGGCGAAUGAACTGAGGCUGACGUCUAAGCCUAGAAAAAUUGG
This is a point mutation called a substitution. This does not affect the entire sequence of the protein, because the mutation is "in frame" meaning the mRNA sequence is still read in the same way by the protein producing machinery. However, it does change the 5th codon from UGC to UGU. If we look up the genetic code, we can see that both of these codons code for cysteine, so there will be no change in the amino acid sequence of the protein