1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Lubov Fominskaja [6]
3 years ago
11

What does DNA contain

Biology
1 answer:
blondinia [14]3 years ago
7 0
DNA is made up of molecules called nucleotides. Each nucleotide contains a phosphate group, a sugar group and a nitrogen base
You might be interested in
Which example best demonstrates the importance of having knowledge of evolutionary relationships?
ratelena [41]
Where are the answers??
7 0
3 years ago
Read 2 more answers
if a microscope has an ocular with a 5x power and has objectives with powers of 10x and 50x what is the total magnification of a
Dafna1 [17]
Low power 50x (5x10)
high power 250x (5x50)

If you want to calculate the microscope power of magnification you have to multiple the magnification power of the ocular with the magnification power of the objectiv.
4 0
3 years ago
Read 2 more answers
How is data used to evaluate outcomes? Provide an example as it relates to an area of nursing.
Zielflug [23.3K]

Answer:

Data is used to evaluate the treatment that is provided to the patient in each episode of nursing diagnosis.

Explanation:

An outcome measure is a tool that is used to assess the current status of the patient that is influenced by the nursing interventions. It is marked by the status of the resolution for individual nursing diagnosis as being either resolved or not.

The data collected by outcome measures supports in establishing the foundation for providing the correct medical treatment to the patient. Which later helps to assess the treatment provided to the patient. It provides reliable and credible justification for the treatment on an individual patient level.

Below are a few examples of these outcome measures;

  • Mortality
  • Timeliness of care
  • Safety of care
  • Patient Experience
  • Effectiveness of care
8 0
3 years ago
Note the two transcribed and translated DNA strips below. The two strips are identical except for a point mutation, where the fi
jekas [21]

Full question attached

Answer/ Explanation:

The original DNA sequence has a point mutation changing a G to a T. The resulting mRNA produced is always complementary to the DNA from which it is synthesised, so the original mRNA sequence has a T, whereas the mutated mRNA has a U. The tRNA is complementary to the mRNA, so the original has a G, and the mutated has a T.

<h3>Original DNA</h3>

GTTGGCGAATGAACGGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGCCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACGGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

<h3>_______________________________________________</h3><h3>Mutated DNA</h3>

GTTGGCGAATGAACTGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGUCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACTGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

This is a point mutation called a substitution. This does not affect the entire sequence of the protein, because the mutation is "in frame" meaning the mRNA sequence is still read in the same way by the protein producing machinery. However, it does change the 5th codon from UGC to UGU. If we look up the genetic code, we can see that both of these codons code for cysteine, so there will be no change in the amino acid sequence of the protein

5 0
3 years ago
How would you categorize a consumer that usually catches and eats prey, but also eats dead animal carcasses?
lianna [129]
Carnivore, hyenas is one example          
5 0
3 years ago
Other questions:
  • Mountain building and rock formation are geologic ____.
    11·2 answers
  • I NEED HELP WITH 2 BIOLOGY QUESTIONS!!!!!!
    7·1 answer
  • The red bluebird controls its feather color with a single allele they can be blue (dominant) or red (recessive). What are the ge
    13·1 answer
  • Noise pollution from a racetrack is an example of a positive externality. t or f
    10·1 answer
  • How have the governments of the Romans and Greeks influenced our modern Western governments?
    8·1 answer
  • What makes a chaparral different from a desert?
    15·1 answer
  • Pick the correct match.
    5·2 answers
  • Which statement best describes the data set?
    15·1 answer
  • Wanna frend me on disc
    7·1 answer
  • True or false.
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!