1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
notka56 [123]
4 years ago
11

Three sixth plus one third?

Mathematics
2 answers:
gayaneshka [121]4 years ago
5 0

Answer:

1.16

Step-by-step explanation:

krok68 [10]4 years ago
4 0

Answer:

Five Sixths (5/6 as a fraction)

Step-by-step explanation:

convert 1/3 to have 6 as the denominator, which is 2/6, and 2/6 plus 3/6 equals 5/6. Hope this helped :)

You might be interested in
Estimates by first rounding each number to the place value 1.8×3.62
Y_Kistochka [10]

By estimation you have:

3.62 ≈ 4.0

1.8 ≈ 2.0

2.0 x 4.0 = 8.0

5 0
1 year ago
What piece of information does C identity for the formula y=ax+bx+c
S_A_V [24]

Answer:

C is the y-intercept

6 0
3 years ago
Cómo se expresa en notación científica 1254​
lisov135 [29]

Answer:

1.254 * 10^3

Step-by-step explanation:

1254 = 1.254 * 1000 = 1.254 * 10^3

7 0
3 years ago
Repeated subtraction using 675 divided by 15
Akimi4 [234]

Answer:

-675/15

Step-by-step explanation:

The problem isn't even complete

4 0
3 years ago
How many digits will be to the right of the decimal point in the product?<br><br> 1.456 × 84
KATRIN_1 [288]

Answer:6

Step-by-step explanation:122.304

4 0
3 years ago
Read 2 more answers
Other questions:
  • Describe this translation.
    6·1 answer
  • What is the solution for the inequality shown below W+1 &lt;-3
    6·2 answers
  • Whats the vertex of the graph y=-x^2
    12·1 answer
  • What is the complementary DNA strand for the DNA strand<br> AATTGGCCATGCATGATTACGA
    7·2 answers
  • Help please ASAP ASAP ASAP
    12·1 answer
  • Apply the distributive property to factor out the greatest common factor.<br> 30+42= equals
    10·1 answer
  • How many seconds are in 20 days math ??
    14·2 answers
  • Answer 15 points <br> ( don’t answer if you don’t the answer )
    11·1 answer
  • Find the value of x that makes the equation true:
    6·2 answers
  • ABCD is a parallelogram. Find x and the length of CD.
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!