1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
fiasKO [112]
3 years ago
14

Which is true about all unicellular and multicellular organisms?

Biology
2 answers:
Lunna [17]3 years ago
6 0
They both reproduce.   
12345 [234]3 years ago
6 0

Answer:

they both reproduce

Explanation:

Unicellular organisms are made up of only one cell that carries out all of the functions needed by the organism, while multicellular organisms use many different cells to function. ... Multicellular organisms are composed of more than one cell, with groups of cells differentiating to take on specialized functions.

You might be interested in
The nervous system reacts to stimuli __________ compared to the endocrine system, adapts __________ compared to the endocrine sy
Fiesta28 [93]

Answer:

B. quickly; slowly; specific

6 0
3 years ago
Bone formation begins when ____________ secrete the initial semisolid organic form of bone matrix called ____________ .
butalik [34]

Answer:

a. osteoblasts

b. osteoid

Explanation:

Osteoblasts are the fundamental cell of bone tissue. They are the cells that synthesize the bone matrix called osteoid from which it is made from the skeleton of bone fish, to the skeleton of humans. Since the bone skeleton is an evolutionary paraphiletic characteristic (it is present in several taxonomic groups that have evolved from the same ancestor).

Osteoblasts are responsible for the development and growth of bones during the juvenile stage of individuals and are also responsible for maintaining adult bone and regenerating bone when it breaks.

Osteogenesis is the process of differentiation of osteoblasts. The cells from which osteoblasts differ are called osteoprogenitors. The differentiation of osteoprogenitor cells, which come from the mesoderm, periosteum or bone marrow, is induced by growth factors called bone morphogenetic proteins (BMPs), capable of inducing the growth of bone, cartilage or connective tissue. When an osteoprogenitor cell receives a BMP signal, it quickly begins to express the genes to generate collagen, osteonectin and alkaline phosphatase, among other compounds necessary for bone growth. When the bone grows, it ends up wrapping some of the osteoblasts and they lose their ability to replicate, at that time they are dedicated to bone maintenance and not to their synthesis and are called osteocytes.

6 0
3 years ago
What mode of nutrition do animal–like protists have?
laiz [17]
They are holozoic or parasitic!
8 0
3 years ago
What is the sugar called that is found in<br> DNA?
pochemuha

Answer:

Deoxyribose

Explanation:

DNA stands for "deoxyribonucleic acid" because it has the sugar deoxyribose. It's named because it has one fewer oxygen than ribose. Be careful not to confuse the two sugars--ribose is in RNA, which stands for "ribonucleic acid."

Attached is a picture of the differences between the two sugars.

3 0
4 years ago
↓ please help asap! ↓
geniusboy [140]
3) decrease

Without the green house effect, earth would be like a solid ball of ice and rock.
Life as we know it wouldn't exist without greenhouse gases.
The temperature would drop below 0° Fahrenheit!
3 0
3 years ago
Other questions:
  • Which of the following best describes an example of how genetic codes of organisms have been used to help hierarchically classif
    13·2 answers
  • HELP!!! PLEASE!! While examining a cell culture, Juan noticed one cell that showed matching halves of chromosomes near opposite
    15·2 answers
  • The half-life of silicon-32 is 710 years. If 70 grams is present now, how much will be present in 200 years? (Round your answer
    12·1 answer
  • Food,water,and wastes are stored inside what
    8·2 answers
  • Laurita and Trey notice that the two hermit crabs in their class prefer peanut butter over the crab food from the pet store. The
    10·1 answer
  • In what way is DNA like a book?
    7·2 answers
  • PLS HELP!
    6·1 answer
  • Which two types of graphs would be appropriate for representing the change in field mouse population over a ten year period?
    7·2 answers
  • TACTTAGAGGCACCACATGGGCCTTGCACT to mRNA
    12·1 answer
  • In which situation could a mutation be passed on to the offspring in an
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!