In diseases, similar patterns of mutations in harmless genes may possibly be a cause or an effect of the disease. To investigate if it is a cause, it is worth looking into the proteins synthesized by the gene and whether it’s structure or functionality is affected by the pattern observed. It is also worth looking into the downstream effects possibly caused by the pattern in the gene. The gene may encode a non coding region which could affect post transcriptional splicing for example.
<span>3’ tcgccctactcgcgtacaccgcgtattgac 5’ </span>turns into:
5' agcgggaugagcgcauguggcgauaacug 3'
adenine becomes uracil hope this helped :)
Explanation:
one of the tools that demographic is used to understand population is the age structure diagram it is sometimes called a population pyramid but it is not always pre-medical in shape this diagram shows the distribution by population in traffic Farm
