1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Nataliya [291]
3 years ago
14

Humans use fossils fuels for fueling automobiles, heating buildings and generating electricity

Biology
1 answer:
Savatey [412]3 years ago
5 0

Answer

C. Ocean processes produce large amounts of fossil fuels over many years.

Explanation:

Humans are the major beneficiaries of fossil fuel. These fossil fuels are formed from decomposing plants and animals. Fossil fuels undergo series of reactions in the ocean which include microbial actions and other complex chemical reactions. These occurs with a build up of it over a long period of time.The fossil fuel formed aren’t usually easily useable and they include natural gas, coal , crude oil etc.

This explains how Ocean processes produce large amounts of fossil fuels over many years.

You might be interested in
All geologic eras are about the same number of years.<br> True or false
rodikova [14]

Answer:

false

Explanation:

6 0
3 years ago
Read 2 more answers
What does the body do during the exhaustion phase of the GAS model? It prepares to fight danger or run from it. It identifies th
ki77a [65]
It prepares to fight danger or run from it. It identifies the primary source of danger.

8 0
3 years ago
Read 2 more answers
What is the complementary strand for the following DNA segment? C A A G T T C G A T G A
Kazeer [188]

GTTCAAGCTACTGTTCAAGCTACT

6 0
3 years ago
In which cycle does the virus to remain dormant?
andriy [413]
D. Lysogenic cycle. In this cycle, viral DNA is inserted into the host cell's DNA. It divides with mitosis, soon creating many infected host cells. Once the lytic cycle is triggered (usually from external factors), the viral DNA is transcribed/translated into viruses.
8 0
3 years ago
Read 2 more answers
Why is retinoblastoma more common in individuals who have inherited the RB deletion and have the genetic predisposition for reti
kvasek [131]

Answer:

Retinoblastoma is more common in people due to the mutation of RB gene in them.

Explanation:

Retinoblastoma is a disease that affects the eyes of an individual. It is more commonly eye cancer which occurs on the retina of the eye. Retinoblastoma mainly affects younger children.

When the RB gene is mutated or it is deleted already on any one of a homologous chromosomes, then only one hit rather that two which is needed to cause the development of retinoblastoma and hence the probability is of retinoblastoma to occur is higher in the individuals who have already inherited the RB deletion and also have a genetic predisposition for the retinoblastoma.

5 0
3 years ago
Other questions:
  • Arrange the events of the earliest stellar formation in sequential order.
    13·2 answers
  • A disadvantage of solar energy is the need for ___
    10·2 answers
  • Which one of the following is not one of the sources of dissolved salts in seawater
    12·1 answer
  • Which is an example of acquisition of natural passive immunity?
    9·1 answer
  • Choose the list that presents the four stages of food processing in the order in which they naturally occur. see concept 41.2
    8·1 answer
  • What are two parts of sexual reproduction that produce genetic variation
    15·1 answer
  • Please help quickly!
    13·1 answer
  • Can new habitats increase or decrease variations
    14·1 answer
  • PLEASE HELP!
    11·1 answer
  • Select the following statement(s) about how the organisms in the food chain store carbon that is(are)
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!