1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
juin [17]
3 years ago
11

Examination of a tissue sample from the central nervous system reveals many darkly pigmented cells. this tissue probably came fr

om the
Biology
1 answer:
dolphi86 [110]3 years ago
3 0
It came from the grey matter.
You might be interested in
A base is best defined as a substance that:
Klio2033 [76]

Answer:

B

Explanation:

a base is a negatively charged anion capable of reacting with anion species such as H ions

5 0
3 years ago
I"M BEING TIMED PLEASE HELP ME!
Ulleksa [173]

The reaction against your skin is equal to the force put upon the object.

Zero net force is when forces are balanced, ie no velocity.

All forces put on an object have an equal and opposite reaction.

3 0
3 years ago
1. The destructive
jok3333 [9.3K]

Answer: erosion

Explanation: Have a nice day! :3

3 0
2 years ago
What is a main difference between a mixture and a pure substance?
bagirrra123 [75]

Answer:

A mixture is made up of more than one element while a pure substance is made up of one type of atom.

Explanation:

4 0
3 years ago
The reproductive cycle in females is regulated primarily by
madreJ [45]
The reproductive cycle in females is regulated primarily by HER HORMONES.  Five hormones to be exact. These hormones are Estrogen, Progesterone, Luteinizing hormone (LH), follicle stimulating hormone (FSH), and gonadotropin releasing hormone.

Estrogen is from the ovaries. It helps regulate the menstrual cycle. It promotes the rapid growth of cell linings in the uterus to prepare for implantation resulting to pregnancy.

Progesterone is also from the ovaries. It is produced after ovulation and maintains the health of the lining within the uterus during pregnancy. If no pregnancy occurs, the progesterone level decrease and results to menses or monthly period.

Gonadotropin Releasing Hormone is secreted by the brain as a result of the hormonal changes that occur every month. It in turn stimulates the production of FSH and LH.

FSH stimulates the follicles inside the ovaries increase the amount of estrogen and progesterone produced in the first two weeks of the menstrual cycle.

The increase in estrogen level by FSH prompts the pituitary glands to release LH. Luteinizing hormone then signals the dominant follicle, made by FSH inside the ovaries, to release its eggs for possible fertilization.




8 0
3 years ago
Read 2 more answers
Other questions:
  • What are the different types of synovial joints?
    5·1 answer
  • What are the steps of passive transport
    5·1 answer
  • Individuals with peanut allergies can exhibit a variety of symptoms following exposure to the peanut allergies. These symptoms c
    9·2 answers
  • Natural selection is a mechanism that acts on individuals within a population. Which is a result of the process of natural selec
    9·1 answer
  • Write the tRNA sequence for the given strand of mRNA<br> AGGUCAUGCAUGGGCAUGCAU
    6·1 answer
  • Enzymes speed up chemical reactions. Which statement correctly identifies the function of the enzymes involved in DNA replicatio
    15·1 answer
  • Which planet has extreme weather with winds reaching up to 2200 km/hr?
    10·2 answers
  • Solution with a lower solute concentration
    13·1 answer
  • Please help me my notes are not helping like at all
    10·2 answers
  • Can someone please explain this to me too? A and B below represent two different slide preparations of elodea leaves. Elodea is
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!