1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
finlep [7]
3 years ago
5

Discuss two benefits of multicellular organisms having some specialized cells rather than all the cells being the same.

Biology
2 answers:
Zigmanuir [339]3 years ago
8 0

Answer and explanation;

-There are advantages to being multicellular rather than unicellular. These include; allowing the organism to be larger, allowing cell differentiation (having different types of cells with different functions) , and also allowing the organisms to be more complex.

-Complex organisms often have specialized cells that carry out different functions. Having specialized cells and systems allows the process such as transport of nutrients and waste to and from all the cells of the body to occur.

dusya [7]3 years ago
7 0
<span>Specialized cells refers to those cells that have develop certain characteristics which enable them to perform specific functions. Specialized cells are very important to muticellular organisms. In these organism, cell differentiate and specialize to form tissues, which come together to form different organs such as brain, heart, lungs, kidneys, etc. Examples of specialized cells in the body are neurons, muscle cells, red blood cells, sperm cells and leukocyte cells. The different organs formed by specialized cells perform different functions in the body.</span>
You might be interested in
Are numbers 4-8 right
Nina [5.8K]

Answer:

Yes, except for one thing.

Explanation:

The numbers are correct, however, the SA/volume ratio does not have units because the cm² cancels out.

8 0
3 years ago
Help me please i need to pass
yanalaym [24]

Answer:

proteins; codons

Explanation:

6 0
2 years ago
What is the mRNA in TACCGGATGCCAGATCAAATC?
Softa [21]

Answer:

AUGGCCUACGGUCUAGUUUAG

3 0
3 years ago
If a mutation is removed from a population due to either genetic drift or natural selection, it is said to be:
MA_775_DIABLO [31]

Answer:

D) extinct

Explanation:

7 0
4 years ago
Read 2 more answers
The hormone cortisol is released by the adrenal gland as a response to physical or psychological stress. It can __________ the h
Inga [223]

Answer:

all increase as cortisol is adaptive hormone

7 0
3 years ago
Read 2 more answers
Other questions:
  • A sample of the tissue from an inflamed, pus-filled area on the lower leg is treated with KOH and stained with GMS. Under the mi
    13·1 answer
  • Homeostasis is defined as
    6·2 answers
  • Scientists at Penn State have sequenced the
    10·2 answers
  • A client has an above-the-knee amputation of the left leg because of arterial insufficiency. to prevent a hip flexion contractur
    5·2 answers
  • Plant like Protist are Heterotrophic .<br><br> True<br><br> False
    14·1 answer
  • Which behavior does this image illustrate? <br> Migration<br> Kenesis<br> Imprinting
    10·2 answers
  • What is difference between MYOCARDIAL INFRACTION and ANGINA PECTORIS ?
    8·1 answer
  • How is a bacterium different from ours
    14·2 answers
  • Hello! Any help would be much appreciated
    6·2 answers
  • Match each term to its description.
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!