1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
xz_007 [3.2K]
3 years ago
14

Over time, a tadpole changes into a frog. Has it evolved?

Biology
2 answers:
viva [34]3 years ago
7 0

Answer:

The correct answer would be "No because its genes are still the same".  

The process by which a tadpole changes into a frog is termed as metamorphosis, not evolution.

During this process, the physical transformation of an organism takes place through cell growth as well as cell differentiation.

No genetic transformation takes place and thus, no evolution takes place during this transformation.

Illusion [34]3 years ago
5 0
No, because its genes are still the same. To evolvewould mean that the frog had one set of genes as a tadpole, then a different set as an adult. It just doesn't work that way. The genes are the same.
You might be interested in
Describe what hydrogen bonding is and how it applies to water
mezya [45]

The attraction between a hydrogen atom on one water molecules and the oxygen atom on another is known as the hydrogen bond.

3 0
3 years ago
A codon is a set of three nucleotides that correspond to a specific amino acid. The table below shows various DNA codons and the
Finger [1]

Answer:

1a. The template DNA strand, from which the mRNA is synthesized, is 5’ CAAACTACCCTGGGTTGCCAT 3’

(RNA synthesis proceeds in a 5’ à 3’ direction, so the template strand and the mRNA will be complementary to each other)

b. The coding DNA strand, which is complementary to the template strand, is 5’ ATGGCAACCCAGGGTAGTTTG 3’

c. The sequence of the mRNA is 5’ AUGGCAACCCAGGGUAGUUUG 3’

(the sequence of the mRNA is complementary to the template strand and identical to the coding strand with U substituted for T)

d. The third codon is 5’ ACC 3’.  Therefore, the corresponding anti-codon is 5’ GGU 3’

2. Below is a table for the genetic code:

T

C

A

G

T

TTT Phe (F)

TTC "

TTA Leu (L)

TTG "

TCT Ser (S)

TCC "

TCA "

TCG "

TAT Tyr (Y)

TAC "

TAA Stop

TAG Stop

TGT Cys (C)

TGC "

TGA Stop

TGG Trp (W)

C

CTT Leu (L)

CTC "

CTA "

CTG "

CCT Pro (P)

CCC "

CCA "

CCG "

CAT His (H)

CAC "

CAA Gln (Q)

CAG "

CGT Arg (R)

CGC "

CGA "

CGG "

A

ATT Ile (I)

ATC "

ATA "

ATG Met (M)

ACT Thr (T)

ACC "

ACA "

ACG "

AAT Asn (N)

AAC "

AAA Lys (K)

AAG "

AGT Ser (S)

AGC "

AGA Arg (R)

AGG "

G

GTT Val (V)

GTC "

GTA "

GTG "

GCT Ala (A)

GCC "

GCA "

GCG "

GAT Asp (D)

GAC "

GAA Glu (E)

GAG "

GGT Gly (G)

GGC "

GGA "

GGG "

a. The following codons can be mutated by one base to produce an amber codon:

CAG    Gln

AAG    Lys

GAG    Glu

TCG    Ser

TTG    Leu

TGG    Trp

TAA    Stop

TAT    Tyr

TAC    Tyr

b. From part a, CAG (Gln) and TGG (Trp) can become amber stop codons through EMS.

c. From part b, both of the resulting amber codons could be suppressed by amber nonsense suppressors generated by EMS.

3a. The codon is the three nucleotide sequence in the mRNA that indicates which amino acid should be incorporated in the growing polypeptide chain.  The anticodon is the complementary three nucleotide sequence in the appropriate tRNA.

b. Template strand is the DNA strand off which the mRNA is synthesized.  The coding, or non-template, strand is the DNA strand complementary to the template strand; it has the same sequence (except for T for U substitutions) as the mRNA.

c. The Pribnow box is a sequence of six nucleotides (TATAAT) positioned at -10 that signals where transcription initiation should begin in prokaryotic DNA.  The Shine-Delgarno sequence is a short, purine-rich region in the mRNA that is complementary to the rRNA within the 16S ribosomal subunit.  The sequence signals which AUG acts as the translation start in mRNA.

4a. False, a wobble allows the anticodon in the tRNA to hybridize with different codons in mRNA.

b. False, a frameshift mutation affects all the subsequent amino acids.

c. False, only one codon (AUG) encodes for the start of protein synthesis; three codons signal the end of protein synthesis.

d. False, the wobble is first base (5’ to 3’) in the anticodon.

e. True, RNA can be used as a template for DNA synthesis in a process known as reverse transcription.

f. True.  For example, a single base substitution causing CAT to change to AAT would signal a termination.

g. False, the Wobble Hypothesis explains how alternate base pairing can occur with the first nucleotide (going from 5' to 3') in the anticodon.

5a. Digestion of RNA with alkali will cleave the strand after each 3’ phosphate.  Therefore, the products remaining will consist of pppNp, Np, and N-OH

b. If RNA was synthesized in the 3’ to 5’ direction (i.e. by adding ribonucleotides to the 5’ end), then the pppNp and Np fragments should be labeled with tritium.

c. If RNA was synthesized in the 5’ to 3’ direction (i.e. by adding ribonucleotides to the 3’ end), th

Explanation:

6 0
3 years ago
What holds the base pairs to each other?
WINSTONCH [101]

Answer:

The two strands are held together by hydrogen bonds between the bases, with adenine forming a base pair with thymine, and cytosine forming a base pair with guanine.

Explanation:

6 0
3 years ago
A triplet of nucleotides in tRNA is called
elixir [45]
A triplet of nucleotides in tRNA is called an anticodon. <span />
7 0
3 years ago
Read 2 more answers
What human activities affect the water, carbon, and the nitrogen cycle what are the consequences
Mademuasel [1]
The nitrogen cycle is impacted by humanswhenever fertilizer is applied to farmland to help crops grow. This adds nitrates to the soil. If soil erodes, the nitrates are transported and deposited in the nearest body of water. This can cause algae to overgrow in a process called eutrophication. The lake will run out of oxygen as the algae die off and bacteria begin their decomposition.Sessile organisms are greatly affected. 
8 0
3 years ago
Other questions:
  • Which of the following organisms would have the HIGHEST predicted gene density (most genes per megabase of DNA) in genomic DNA?A
    11·1 answer
  • The neurons that control the basic rhythm for breathing are located in the
    11·1 answer
  • In waste management, pen, disposable cameras, and paper coffee cups are examples of what good?
    9·1 answer
  • Calculate the ratios of the genotypes and phenotypes of the offspring in the F1 generation.
    14·1 answer
  • HELPPPPP!!!!
    10·1 answer
  • ceanic crust is best described as _______. a. thin and young b. continuously replenished c. a majority of Earth’s crust d. all o
    7·2 answers
  • What type of organic molecule comprises the majority of a potato? Monosaccharides
    14·1 answer
  • What type of fatty acid has one or more double bonds in its molecular structure?
    12·1 answer
  • What are some negative side effects of artificial selection on corn, watermelon and peaches?
    5·1 answer
  • What is the main product of the light-dependent reactions of photosynthesis?
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!