1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Stolb23 [73]
3 years ago
11

A medical student makes a frontal cut of a cadaver's abdomen. The two new sections of the abdomen could be referred to as the?

Biology
2 answers:
dmitriy555 [2]3 years ago
7 0

Answer:

D. anterior and posterior sections

Explanation:

A frontal cut is the one that divides the human body parts into anterior and posterior parts. A median cut is also called saggittal plane and divides the body parts into right and left part while the transverse cut obtains upper and lower parts of the body. Since the student makes a frontal cut of a cadaver's abdomen. The two new sections of the abdomen could be referred to as the anterior and posterior sections.

LekaFEV [45]3 years ago
5 0
The two new sections of the abdomen could be referred to as the anterior and posterior sections. The correct option among all the options that are given in the question is the last option or the fourth option or option "d". I hope that this is the answer that you were looking for and the answer has come to your help.
You might be interested in
Which of the following cells is formed by meiosis?
Lilit [14]

Answer:

B. A sperm cell

Explanation:

Meiosis creates gametes/sex cells, such as the sperm and egg.

So, sperm cells are formed by meiosis.

Meiosis doesn't create fertilized eggs, it instead creates normal egg cells.

Meiosis also doesn't create heart and bacterial cells because those are made in mitosis.

So, B is the correct answer.

6 0
3 years ago
Choose THREE reasons why less energy is passed from one tropic level to the next?
Pavlova-9 [17]
I’m pretty sure it’s A, C, and F
7 0
3 years ago
Read 2 more answers
C. sexual reproduction
Andrew [12]
3. A boat is moved forward by a current
4. The micronucleus
5. Alternation of generations
6. A. They are eaten by some whales
7. B. Oxygen is removed from the ocean by decomposition
3 0
3 years ago
What is the best way to answer a young child’s question about sex and sexuality?
nevsk [136]

Answer: birds and the bees/cartoon

Explanation:if they are 13 an up tell them about the birds and the bees but if they younger than that show them a cartoon

4 0
3 years ago
Read 2 more answers
Is it possible for marine scientists to get an exact count of a population? Why or why not?
Nady [450]

No, that is completely impossible. The reasoning behind it is because if its a large group of fish they're swimming back and forth ect, ect, it would be like counting a bowl of rice, but not being able to take any out. To get around these counting problems, scientists take data from just a small portion of the population called a sample. They take several samples and then use the average size of those samples to calculate an estimate of the entire population size.


If you need help feel free to ask!

8 0
3 years ago
Read 2 more answers
Other questions:
  • The newly-discovered organism Yawle nhoj, has a diploid chromosome number of 56. Suppose that one of the chromosome pairs fails
    13·1 answer
  • Describe the function of carbohydrates in the human body.
    15·2 answers
  • Definition: This is the application of a wide range of sciences to answer questions of interest to a
    14·2 answers
  • Dylan has two cubes of iron. The larger cube has twice the mass of the smaller cube. He measures the smaller cube. Its mass is 2
    12·1 answer
  • In people who are regularly physically active, extra fat consumed in the diet is stored first in In people who are regularly phy
    12·1 answer
  • 2. What does the term “-troph” mean?
    15·2 answers
  • Circle the letter of the correct choice.
    11·1 answer
  • What is the most significant difference in current weather forecasting methods compared to what was done in the past?
    10·2 answers
  • Which type of specialized cells would be found in an animal’s nervous system?
    13·1 answer
  • what is the sequence of mRNA codons that are synthesized during transcription that go with TACCGGATGCCAGATCAAATC, TACGGGGGCGTAAC
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!