1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
slamgirl [31]
3 years ago
8

A species of lizards migrates to a group of islands in the ocean. Over time, they diversified and evolved into several different

species. Each species has a unique jaw shape that allows it to eat its own specific diet. This is an example of:
A) gradualism because one species evolved into several different species over a relatively short amount of time.

B) adaptive radiation because one species evolved into several different forms that occupy different niches.

C) coevolution because the evolving lizard species changed in order to interact with the changing environment.

D) convergent evolution because one species evolved into multiple species that live alongside each other.
Biology
2 answers:
photoshop1234 [79]3 years ago
8 0

Answer:b

Explanation:adaptive radiation

e-lub [12.9K]3 years ago
4 0
The answer to your question is 
B. adaptive radiation because one species evolved into several different forms that occupy different niches<span />
You might be interested in
Can some one code this dna
cluponka [151]

Answer:

After replication, identical copy of the Double stranded DNA is produced. Complementary strand for each of stand given below is

Explanation:

 1. AACGTACGATCGATGCACATGCATGGCTACGC

Complementary strand  

     TTGCATGCTAGCTACGTGTACGTACCGATGCG

Protein encode: NVRSMHMHGY

2. CCCGGGTATGCATGTACGTACGTCGTATATCG

Complementary strand  

     GGGCCCATACGTACATGCATGCAGCATATAGC

Protein encode: PGYACTYVVY

3. CGCGATCGAGCGATCGACGAATGCCTAGTTTT

Complementary strand  

   GCGCTAGCTCGCTAGCTGCTTACGGATCAAAA

Protein encode: RDRAIDECLV

4. TTAAACGAGCTGCTAGCTATTTTTAAAACCCCG

Complementary strand  

   AATTTGCTCGACGATCGATAAAAATTTTGGGGC

Protein encode: LNELLAIFKTP

7 0
3 years ago
What decomposes animals in a rainforest?
Crazy boy [7]

Answer:

things such as termites, slugs, scorpions, worms, and fungi

6 0
3 years ago
Trying to explain a solar eclipse is an example of
luda_lava [24]

c.scientific inquiry.

Scientific inquiry refers to the diverse ways in which scientists study the natural world and propose explanations based on the evidence derived from their work

hope this helped :)

4 0
3 years ago
How do the charges of objects determine if they are attracted or repelled by one another
Lisa [10]
They determine the north and south ends
7 0
3 years ago
The hormone levels during the menstrual cycle are shown below.what would happen if the hormone levels did not have their peak ju
Vesna [10]

During week 2 of the menstrual cycle (day 8 to day 14 or ovulation), estrogen levels rise until it reaches its peak. Typically, days 12-14 have the highest levels of estrogen, which causes an increase in Luteinizing Hormone, which is responsible for the release of the egg cell. If hormone levels fail to reach its peak before day 14, ovulation is not possible because the egg cannot be released. Pregnancy may be highly unlikely.

3 0
3 years ago
Read 2 more answers
Other questions:
  • How should Meredith make her model of the rock?
    14·2 answers
  • G why are glucose ketone bodies or protein not normally detected in urine
    14·1 answer
  • Anne was observing a cell under a microscope which was undergoing binary fission. Which type of cell was Anne observing? 1 Eukar
    15·1 answer
  • The United States has the most reserves of which fossil fuel?
    9·2 answers
  • In a plant’s life cycle, how many sporophyte generations occur between one gametophyte generation and the next time that eggs an
    10·2 answers
  • Atlas is successfully able to use his pincer grip to grab and manipulate objects in his environment. The pincer grip is the abil
    15·1 answer
  • Compare the reproduction in Hydra and Amoeba?​
    11·1 answer
  • What is the correct mRNA transcription of the following DNA sequence? ATGGCACCTTAC A. UACCGUGGAAUG B. CATTCCACGGTA C. AUGGCACCUU
    14·1 answer
  • Reconstruct the phylogeny that most simply and accurately accounts for the distribution of synapomorphies among ingroup species.
    11·1 answer
  • Why do ostriches have vestigial features?
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!