Explain what is a buffer ?

Biology

1 answer:

inna [77]3 years ago

5 0

Answer:

a person or thing that prevents incompatible or antagonistic people or things from coming into contact with or harming each other:

Explanation:

You might be interested in

1. When a horizontally positioned plant responds to gravity, (1 point)

arsen [322]

1-auxins in the lower sides of stems cause cell elongation that bends the stem upright
2-thigmotropism.
3-phototropic and gravitropic
4-the production of anthocyanin and the breakdown of chlorophyll.
5-exposing the plant to a brief period of light in the middle of the night

5 0

3 years ago

Read 2 more answers

BLAST (Basic Local Alignment Search Tool) is a powerful tool for comparing unknown sequences to sequences in online databases. I

storchak [24]

Answer:

This is a well conserved sequence.

Explanation: BLAST a way to match or align a string of DNA or protein sequence to those that are already in a database. The way that this is done is by using statistics carefully to calculate the significance of the match. The BLAST result will produce 4 categories Max Score, Total Score, Query cover, E-Value Percent Identity. The Accession will indicate database of the sequence. In this Sequence: AAGACCCGCCGGGAGGCAGAGGACCTGCAGGGTGAGCCAACCGCCCATTGCT covers over 98.08% identity to the coding sequence (cds) of insulin. This sequence appears to be in a conserved region for many of the listed organism. This suggest that this part of the coding sequence for this protein is highly conserved

3 0

3 years ago

All cells have a cytoplasm and a?

Anna35 [415]

Plasma membrane,DNA,ribosomes,and ctyoplasm

5 0

3 years ago

The movement of particles from an area of high concentration to an area of low concentration

Montano1993 [528]

Answer:

Passive Transport

Explanation:

The movement of molecules from an area of High concentration to an area of lower concentration in a living cell is called Passive Transport.

Passive Transport does not require energy input.

An example is Diffusion.

5 0

2 years ago

_______parenting is a belief, or a way of living, that teaches and emphasizes good behavior in the process of raising children.

sammy [17]

Answer:

Positive is the correct answer.

Explanation:

5 0

3 years ago